Rnaeasy mini extraction kit

Embryos from three biological repeats were set on ice and dissociated as described earlier. Nuclear and cytoplasmic fractions were separated by two washes in nuclei isolation buffer (Tris-HCl pH 7.4 10mM, NaCl 10mM, MgCl2 3mM and 0.1% IGEPAL CA-630) followed by 5 minutes centrifugation at 500 x g. RNA was extracted from the two fractions with the RNAeasy Mini Extraction kit (Qiagen, 74044, UK), converted in cDNA via the SuperScript™ III Reverse Transcriptase (Thermo Fisher, 18080093, UK) and used for qPCR.

Total mRNA was extracted from unstimulated PBMC as well as from PBMC 1, 4 and 6 h after HSV-1 infection using the RNA easy Mini extraction kit (Qiagen, Hilden, Germany) and was eluted in RNAse-Free water. Total RNA concentration was determined by spectrophotometer (OD: 260 nm). Purity was determined as the 260 nm/280 nm OD ratio with expected values between 1.8 and 2.0. RNA was treated with TURBO DNA free DNAse (Ambion INC, Austin, TX, USA) and retro transcribed with High-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA), as specified by manufacturers. cDNA samples were stored at – 20 ^°C until use.

The Spi-B/POU2AF1 gene expression analysis in peripheral blood mononuclear cells (PBMCs) could be performed at baseline and after 24 months of therapy in 13 patients with RRMS and 10 age- and sex-matched HCs. PBMCs were isolated from peripheral blood by density gradient centrifugation (Lympholyte Separation Medium, Cedarlane, Hornby, Ontario, CA, USA) and stored at −80°C until use.
Total RNA was extracted from PBMCs (RNAeasy Mini extraction kit, Qiagen), quantified and reverse-transcribed to cDNA, as previously described (19 (link)). RNA quality and purity were assessed by the analysis of spectrophotometric of 260/280 (≥2.0) and 260/230 ratio (range of 2.0–2.2). Pre-designed and validated assays (Thermo Fisher Scientific) were used for relative quantification of the target genes (Spi-B and POU2AF1) and for two previously selected housekeeping genes (GAPDH, YWHAZ). Quantitative PCR (qPCR) experiments were performed on CFX Touch real-time PCR (Bio-Rad) in triplicate, including the positive and non-template controls. All procedures were carried out under stringent conditions to avoid contamination. A relative expression analysis was performed by qBase+ software [Version: 3.0, Biogazelle], using a comparative cycle threshold method (20 (link)). The change in gene expression fold compared with baseline (delta fold) was calculated for each subject.

Total RNA from HG001, Rom^R and Rom^R ΔfarE strains was extracted from 8 h cultures in TSB medium using the RNAeasy Mini Extraction Kit (Qiagen) following the manufacturer’s instructions followed by DNaseI treatment overnight (Promega). The RNA was quantified using NanoDrop 2000 (Thermo Fisher Scientific) and used for qPCR experiments. Expression was detected using the Power Sybr RNA to Ct 1 step kit (Thermo Fisher Scientific) following manufacturer’s instructions with the following oligonucleotides: psmα1 5′TCATCGCTGGCATCATTA′3 and 5′CATCGTTTTGTCTCCTG′3. The gyrB gene using primers 5′TTAGTGTGGGAAATTGTCGATAAT′3 and 5′AGTCTTGTGACAATGCGTTTACA′3 was used as reference for normalization of expression levels of target genes in each condition. The cycling conditions were as follows: cDNA production 48°C during 30 min, for qPCR denaturation at 95°C for 5 min, 40 cycles at 95°C for 25 s, 60°C for 1 min. Relative changes in the expression of individual genes was obtained using −ΔΔCt method. At least three independent cultures were analyzed for each conditions. RT qPCR was performed using AriaMx3005 (Agilent).

Total RNA was extracted from HBECs using an RNAeasy mini extraction kit (#74106, Qiagen, Hilden, Germany). Complementary DNA was synthesized with the QuantiTect reverse transcription kit (#205311, Qiagen, Germany). The expression level of the target genes was determined by quantitative real-time PCR using the QuantiTect SYBR Green PCR kit (#204143, Qiagen, Germany). All the reactions were performed with a LightCycler480 II real-time PCR machine (Roche Diagnostics, Penzberg, Germany). The relative expression levels of CHRNA7 subunit genes were normalized to the expression levels of GAPDH. The sequences of primers used were as follows: CHRNA7-F, 5′-AGC CAG CAA TTC TGA GTT CTG-3′; CHRNA7-R, 5′-TTG CCC ATC TCC AGT GAA TC-3′; CD274-F, 5′- GGC ATC CAA GAT ACA AAC TCA AAG-3′; CD274-R, 5′-CTT CCT CTT GTC ACG CTC AG-3′; GAPDH-F, 5′-GTC AGT GGT GGA CCT GAC CT-3′; GAPDH-R, 5′-TGA GCT TGA CAA AGT GGT CG-3′.