PCR and COLD-PCR products were purified using HiYieldGel/PCR DNA Fragments Extraction Kit (RBCBioscience, New Taipei City, Taiwan). Sequencing analysis was performed on both strands using the BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies Applied Biosystems, Austin, Texas, USA) and a model 310 automated sequencer (Life Technologies Applied Biosystems). Variant nomenclature follows the Human Genome Variation Society recommendations (http://www.hgvs.org ). The DNA variant numbering is based on the NF2 cDNA sequences (GenBank accession number NM_181832.2) with the A of the ATG translation-initiation codon numbered as +1.
Hiyield gel pcr dna fragments extraction kit
Manufactured by RBC Bioscience
Sourced in United States
The HiYield Gel/PCR DNA Fragments Extraction Kit is a product designed for the rapid and efficient purification of DNA fragments from agarose gels or PCR reactions. The kit utilizes a silica-based membrane technology to selectively bind DNA, allowing for the removal of agarose, primers, nucleotides, and other contaminants. The purified DNA can then be used in various downstream applications, such as sequencing, cloning, and enzymatic reactions.
Automatically generated - may contain errors
Lab products found in correlation
Pgem t vector, by Promega (2 mentions)
Fluorescein 12 dutp, by Jena Biosciences (1 mentions)
Dfc300 fx ccd camera, by Leica (1 mentions)
Dmr microscope, by Leica (1 mentions)
Firefly luciferase, by Promega (1 mentions)
Pgl3 basic vector, by Promega (1 mentions)
Tae buffer, by Merck Group (1 mentions)
Agarose gel, by Cambrex (1 mentions)
Ion ampliseq cancer hotspot panel v2, by Thermo Fisher Scientific (1 mentions)
Hotstartaq plus dna polymerase, by Qiagen (1 mentions)
Bigdye terminator 1.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Abi prism 310 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Zr dna sequencing clean up kit, by Zymo Research (1 mentions)
Abi prism 3130xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Dreamtaq green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Taq dna polymerase, by RBC Bioscience (1 mentions)
Escherichia coli dh5α competent cells, by RBC Bioscience (1 mentions)
Hiyield plasmid mini kit, by RBC Bioscience (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Luria bertani agar plates, by Duchefa Biochemie (1 mentions)
11 protocols using hiyield gel pcr dna fragments extraction kit
1
NF2 Gene Variant Sequencing Protocol
2
Fluorescence In Situ Hybridization for Chromosomal Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the FISH experiments, cytological slides of individual anthers and seedling shoot apical meristems containing well-spread chromosomal plates were used. The chromosome spreads, DNA probe labeling, and FISH procedures were conducted as previously described [39 (link)]. Tandem repeats Spelt1 [40 (link)], pTa71 (for the localization of 45S rDNA) [41 (link)], and As5SDNAE (for the localization of 5S rDNA) [42 (link)] were used as the DNA probes for FISH. The PCR-amplified fragments were purified using the HiYield Gel/PCR DNA Fragments Extraction Kit (RBC Bioscience, Taiwan) and used as the DNA probes in the standard oligolabeling protocol as previously described [39 (link), 43 (link)]. The DNA probes were directly labeled with Cy-3, fluorescein-12-dUTP, and ATTO-425 (Jena Bioscience, Germany). AT-specific 4′,6-diamidino-2-phenylindole (DAPI) and GC-specific chromomycin A3 (CMA3) fluorochromes were used for differential staining to reveal AT-enriched heterochromatin patterns and GC-enriched heterochromatic clusters in the nuclear organizer regions (NORs) on chromosomes 1 and 6 in the Ae. speltoides genome. The slides were examined on a Leica DMR microscope equipped with a DFC300 FX CCD camera.
3
Cloning c-myc Promoter into pGL3-Basic
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was used to amplify the c-myc core promoter from HeLa genomic DNA using the c-Myc promoter primer as shown in Table 1 . PCR conditions are described in Supporting information: S1 Table . The 468 bp PCR product was purified using a HiYield™ Gel/PCR DNA Fragments Extraction Kit (RBC Bioscience, Taipei, Taiwan) and cloned into pGEM-T vector (Promega, Madison, WI, USA). The constructed plasmid was transformed into Escherichia coli (E. coli) strain DH5α. The product containing c-myc core promoter in pGEM-T vector was subcloned into the pGL3-Basic vector, which lacks eukaryotic promoter sequences and contains the firefly luciferase (Promega) as a reporter. The c-myc core promoter sequence was confirmed by sequencing analysis.
4
Gibson Assembly for FMDV Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Gibson assembly (GA) reaction was used to assemble two FMDV fragments to the pKLS3 vector [22 (link)] to generate an infectious clone. The pKLS3 vector was linearized with StuI (New England BioLabs, Ipswich, MA, USA) and then purified using the HiYield™ Gel/PCR DNA Fragments Extraction Kit (RBC Bio-science, Taipei City, Taiwan). O189 F1 and F2 fragments prepared from the previous step were also purified similarly. Then, O189 F1, O189 F2, and the linearized pKLS3 vector were assembled in an isothermal GA reaction (Gibson Assembly® Cloning Master Mix) (New England BioLabs, Ipswich, MA, USA). following an optimized protocol based on the manufacturer’s suggestion (New England BioLabs, Ipswich, MA, USA). Briefly, 25 ng each of DNA fragments (linearized pKLS3, O189 F1 and O189 F2) was mixed with 10 μL of 2X Gibson Assembly Master mixture in a 20 µL reaction and subsequently incubated at 50 °C for 1 h in a thermocycler. The assembled DNA fragments were examined by electrophoresis through 0.8% agarose gel (Cambrex Bio Science, Rockland, MA, USA) in 1X TAE buffer (Sigma-Aldrich, St. Louis, MO, USA). In addition, the GA reaction of FMDV type A (NP05) was also performed to combine the linearized pKLS3 with NP05 F1 and F2 using the Gibson Assembly kit and method as described above.
5
Optimized DNA Extraction Using Minicolumns
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To purify DNA, the HiYield Gel/PCR DNA Fragments Extraction Kit (RBC Bioscience) was purchased and mini-columns were made by breaking DNA binding columns and refilling the column matrix into filtered tips (VistaRak cat No:4060-1333 VistaLab Technologies Inc.) whose tip was trimmed just beneath the filter. Eight to twelve min columns were made from a single column. To fit the mini column to a 2-mL collection tube, two kinds of adapter were made. One was made by cutting 0.5 mL tubes into top and bottom parts, and the top part was used. The other was made by cutting the tip rack. We eluted DNA to 0.5 mL tube with 2 to 5 µL of water or TE buffer. For reproducibility, we avoided too long incubation of DNA with salt solution (DF buffer) before column passage (each sample was mixed with the salt solution and immediately placed on a column and centrifuged). The DNA samples purified after prolonged incubation seem to contain co-purified dNTPs that prevented DNA from degradation upon T4 DNA treatment that was designed to be conducted in the absence of dNTPs. To obtain stable TdT reaction results, the DNA binding column was vacuum-dried before elution, and less than 1/5 of the elution fraction was used.
6
Sanger Sequencing Confirmation of Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microliter of WGA Amplified DNA was used for confirmation of selected mutations from the analyzed panel by Sanger sequencing. The sequence of the primers used for PCR reactions was the same of the Ion AmpliSeq™ Cancer Hotspot Panel v2 (Life Technologies). The reaction mixture (final volume 20 μl) contained 1X PCR Buffer, 0.8 μM dNTPs, 1 μM primers and 0.5 U HotStarTaq Plus DNA Polymerase (QIAgen, Germany). The thermal profile was: 95°C for 5 min, 40 cycles at 94°C for 30 sec, 58°C for 30 sec, 72°C for 45 sec, then 72°C for 10 min. PCR products were purified using the HiYield Gel/PCR DNA Fragments Extraction Kit (RBC Bioscience) and sequenced using the BigDye Terminator 1.1 CycleSequencing kit (Applied Biosystems). Sequence reaction was purified using ZR DNA Sequencing Clean-Up Kit (Zymo Research) and analyzed using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems).
7
Mitochondrial Cytochrome b Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated using the Tissue and Cell Genomic DNA Purification Kit (Hopegen Biotechnology Development Enterprises, Taichung, Taiwan). The extraction of genomicDNA was performed according to the manufacturer’s instructions with repeat membrane binding, salt washing, and centrifugation. Polymerase chain reaction (PCR) amplification was performed using the primer pair CypbF1 5′-TGACTTGAAGAACCACCGTTGTA-3′ and CypbR1 5′- CGATCTTCGGATTACAAGACCGATG -3′ [37 (link)] to target the 1,091 bp mtDNA cytochrome b (cytb) gene. Following an initial denaturation step at 95°C for 2 min, the PCR comprised 35 cycles of denaturation (94°C, 15 s), annealing (46°C, 15 s), and extension (72°C, 30 s), followed by a final extension for 10 min at 72°C, on an MJ MINI PTC-1148C Personal Thermal Cycler (Bio-Rad, Mississauga, Canada) and using a PCR Master Mix Kit (Hopegen Biotechnology Development Enterprises, Taichung, Taiwan). Resulting PCR products were visualized through electrophoresis and purified using the HiYield Gel/PCR DNA Fragments Extraction Kit (RBC Bioscience, Taipei, Taiwan) prior to sequencing. Purified products were Sanger-sequenced using an ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) and aligned using MUSCLE [38 (link)] and Molecular Evolutionary Genetics Analysis software (MEGA X) [39 (link)]. The output was later trimmedvisually.
8
DNA Fragment Purification with RBC Kit
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For DNA fragment purification, we used PCR Purification Kit (HiYield™ Gel/PCR DNA Fragments Extraction Kit) from RBC Bioscience.
9
Amplification of Retrotransposon Sequences from Plant Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from the young leaves of the individual TS43 genotype using the CTAB method [31 (link)]. Degenerate oligonucleotide primers were used for PCR amplification from the genomic DNA of conserved regions of the RT genes of the Ty1-copia [32 (link)], Ty3-gypsy [33 (link)], and LINE [34 (link)] retroelements. PCR amplifications were conducted in 25 μl reaction volumes containing 12.5 μl of DreamTaq™ Green PCR Master Mix (2x; Fermentas), 150–200 ng of genomic DNA from TS43 leaves, and each degenerate primer in a final concentration of 2 μM. For PCR amplification of the individual TE clones, 0.5–1.0 ng of plasmid DNA was used as the template and standard T7 and SP6 primers for the pGEM®-T Vector (Promega, USA) were employed in a final concentration of 0.5 μM. The PCR conditions were as follows: an initial denaturation for 4 min at 94°C, 35 cycles of amplification (30 s at 94°C, 1 min at 50°C, 1 min at 72°C), and a final elongation of 10 min at 72°C. The PCR-amplified fragments were purified using the HiYield Gel/PCR DNA Fragments Extraction Kit (RBC Bioscience, Taiwan).
10
DNA Extraction and COI Amplification in Larval Fish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 106 genomic DNA samples from representative larval fish were extracted from muscle tissues using proteinase K digestion followed by the standard phenol chloroform method (Sambrook & Russell, 2001) . The quality of the extracted DNA was determined on a 1% agarose gel. The fragments of the COI gene were amplified with four primers (FishF1, FishF2, FishR1, and FishR2) that were described by Ward et al. (2005) (link) using PCR. A total volume of 25 l of a PCR mixture contained 1× Taq buffer, 2.5 mM MgCl2, 0.4 M of each primer, 1 M dNTPs, 0.625 U of Taq DNA polymerase (RBC Bioscience Corp., New Taipei, Taiwan) and 50-100 ng of the extracted DNA. The thermal conditions included initial denaturation for 2 min at 95C followed by 35 cycles of denaturation for 30 sec at 94C, annealing for 30 sec at 54C, extension for 1 min at 72C and an extension for 10 min at 72C. The PCR products were visualized by 1% agarose gel electrophoresis under UV light.
The amplified PCR products were purified with the HiYield ™ Gel/PCR DNA Fragments Extraction kit (RBC Bioscience) according to the manufacturer's instructions. All purified PCR products were sequenced in one direction with the FishF1/FishF2 primers complementary to the 5' ends of the COI gene fragments by Macrogen Inc. in South Korea.
The amplified PCR products were purified with the HiYield ™ Gel/PCR DNA Fragments Extraction kit (RBC Bioscience) according to the manufacturer's instructions. All purified PCR products were sequenced in one direction with the FishF1/FishF2 primers complementary to the 5' ends of the COI gene fragments by Macrogen Inc. in South Korea.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!