Sso fast evagreenr supermix

Total RNA was extracted from Mec-1 cells and retrotranscribed as previously described [22 (link)]. Two independent reverse transcription reactions were performed on each RNA sample. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed in triplicate on each cDNA on 96-well optical PCR plates (Sarstedt) using SSo Fast EvaGreenR SuperMix (Bio-Rad) according to the manufacturer’s instructions and a CFX96 Real-Time system (Bio-Rad). After an initial denaturation for 3 min at 95 °C, denaturation in the subsequent 42 cycles was performed for 10 s at 95 °C, followed by 30 s of primer annealing at 60 °C. Results were processed and analyzed using CFX Manager Version 1.5 software (Bio-Rad). Transcript levels were normalized to HPRT1, used as a housekeeping gene. Primers used for amplification are listed in Additional file 1: Table S1.

The presence of OsHV-1 DNA was measured by quantitative PCR. Total DNA was extracted from ~ 25 mg w.w. of oyster gill and mantle using the QIAamp® DNA Mini Kit following the manufacturer’s instructions (Qiagen). The purified DNA samples were quantified with a NanoDrop spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA) and diluted to 5 ng/μl for the amplification reaction targeting the catalytic subunit of the viral DNA polymerase (AY509253 ORF100) [69 ]. Five μl of DNA were added to a qRT-PCR reaction mix composed of 12.5 μl SsoFast™ EvaGreenR Supermix (Bio-Rad Laboratories, Segrate, Milano), 1.25 μl of each primer (HVDP-F: 5′ ATTGATGATGTGGATAATCTGTG 3′; HVDP-R: 5′ GGTAAATACCATTGGTCTTGTTCC 3′) diluted at the concentration of 0.5 μM, and 5 μl of water. The amplification reactions were performed in a Rotor-Gene Q thermocycler (Qiagen) as follows: 1 cycle of polymerase activation at 95 °C for 5 min; 40 cycles of amplification at 95 °C for 30 s, 60 °C for 1 min, and 72 °C for 45 s and a final step for melting temperature curve analysis from 65 to 95 °C (10 s/step, ramp rate 0.5 °C/sec) [70 (link)]. The absolute number of OsHV-1 DNA copies/μl was determined by comparing the C_t values resulting from a standard curve. Plasmidic DNA including the OsHV-1 target region was serially diluted 1:10 in the range 10–10⁶ DNA copies/μl and used to compose the standard curve.

Total RNA was extracted from THP-1, human B cells and HEK-293 using the RNeasy Plus Mini Kit (Qiagen) and retrotranscribed using the iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). Three independent reverse transcription reactions were performed on each sample. Real-time quantitative PCR (qRT-PCR) was performed in triplicate on each cDNA in 96-well optical PCR plates (Sarstedt, Nümbrecht, Germany) using SSo Fast EvaGreenR SuperMix (Bio-Rad) and a CFX96 Real-Time system (Bio-Rad). Results were processed and analyzed using CFX Manager Version 1.5 software (Bio-Rad). Transcript levels were normalized to HPRT1 used as housekeeping control for all the reactions. The primers sequences are as follow: HPRT1 forward 5’-AGATGGTCAAGGTCGAAG-3’ and reverse 5’-GTATTCATTATAGTCAAGGGCATAT-3’; IRF-1 for-ward 5’-CGTGGGACATCAACAAGGA-3’ and reverse 5’-GTGGAAGCATCCGGTACACT-3’.