Aflatoxin b2

The following reference standards were purchased: aflatoxin B₁ (AFB₁, > 99%), aflatoxin B₂ (AFB₂, > 99%), aflatoxin G₁ (AFG₁, > 99%), aflatoxin G₂ (AFG₂, > 99%), aflatoxin M₁ (AFM₁, > 98%), and sterigmatocystin (ST, > 99%) all solved in acetonitrile from Sigma-Aldrich Chemie GmbH (Taufkirchen, Germany), aflatoxin M₂ (AFM₂) in acetonitrile (> 98%) and aflatoxicol (AFL, > 99%) from Cfm Oskar Tropitzsch GmbH (Marktredwitz, Germany), and O-methylsterigmatocystin (OMST, > 95%) from Cayman Chemical (Ann Arbor, MI, USA). Of these standards, two standard mixtures were generated: standard mixture 1 (containing 640 nmol/L of AFB₁, AFB₂, AFG₁, and AFG₂ in acetonitrile) and standard mixture 2 (containing 640 nmol/L of AFM₁, AFM₂, ST, and AFL as well as 608 nmol/L of OMST in acetonitrile). All further chemicals and solvents were of analytical grade. Deionized water was obtained from an in-house ultrapure water system (LaboStar, Erlangen, Germany).

Mycotoxin standards comprising of aflatoxin B₁ (AFB₁), aflatoxin B₂ (AFB₂), aflatoxin G₁ (AFG₁), aflatoxin G₂ (AFG₂), fumonisin B₁ (FB₁), fumonisin B₂ (FB₂), deepoxy-deoxynivalenol (DOM), 15-acetyl-deoxynivanelol (15-ADON), neosolaniol (NEO), OTA, alternariol (AOH), alternariol monomethyl ether (AME), zearalenone (ZEN), nivalenol (NIV), deoxynivanelol (DON), 3-acetyl-deoxynivanelol (3-ADON), sterigmatocystin (STE), roquefortine C (ROQ C), enniatin B (ENN B), fusarenon-X (FUS-X), HT-2 toxin (HT-2) and zearalanone (ZAN) were obtained from Sigma-Aldrich (Bornem, Belgium). Fumonisin B₃ (FB₃) was procured at Promec Unit (Tynberg, South Africa), while T-2 toxin (T-2) and diacetoxyscirpenol (DAS) were purchased from Biopure Referenzsubstanze (Tulln, Austria).

Gold(III) chloride trihydrate (HAuCl₄·3H₂O), ochratoxin A (OTA), ochratoxin B (OTB), aflatoxin B1 (AFT B1), and aflatoxin B2 (AFT B2) were purchased from Sigma-Aldrich. Sodium citrate dehydrate, adenosine triphosphate (ATP), 17β-estradiol (EST), and oxytetracycline hydrochloride (OTC·HCl) were purchased from Heowns Biochemical Technology Co., Ltd. The nucleotide sequence of the OTA aptamer was GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA (5′ to 3′) (Cruz-Aguado and Penner, 2008 (link)). The sequences of oligonucleotide aptamers for the other analytes are shown in Table S1. These aptamers were synthesized then purified by HPLC (Sangon Biotech, Shanghai, China). Stock solutions (100 μM) of the prepared aptamers were dissolved in ultrapure water then stored at −18°C. All reagents employed were of analytical grade, and all solutions were prepared using ultrapure water (18.2 MΩ·cm⁻¹, Sartorius Arium Pro VF, Germany).

Ochratoxin A was purchased from Enzo Life Sciences (Farmingdale, NY, USA) and used as received without further purification. Ochratoxin A was dissolved in ethanol to a concentration of 61.9 µM (25 mg/mL) then further diluted for titration in the same media as measurements were performed. Aflatoxin B1, aflatoxin B2, aflatoxin G1, aflatoxin G2, and fumonisin B1 were purchased from Sigma Aldrich (St. Louis, MO, USA). 20X phosphate-buffered saline (PBS) was purchased from Sigma Aldrich (St. Louis, MO, USA), diluted to 1X concentration and pH corrected to 7.4 using sodium hydroxide and hydrochloric acid. Starbucks brand unsweetened iced coffee was purchased from Ralphs Supermarket (Santa Barbara, CA, USA) and used as received. Oligonucleotides were synthesized by Biosearch Technologies (Novato, CA, USA) and purified by dual HPLC. 6-mercapto-1-hexanol and tris(2-carboxyethyl)phosphine were purchased from Sigma Aldrich (St. Louis, MO, USA) and used as received.

AFB₁ (purity ≥98.0%), aflatoxin B₂ (AFB₂, purity ≥ 98.0%), aflatoxin G₁ (AFG₁, purity ≥ 98.0%), aflatoxin G₂ (AFG₂, purity ≥ 98.0%), ochratoxin A (OTA, purity ≥ 98.0%), deoxynivalenol (DON, purity ≥ 98.0%), zearalenone (ZEN, purity ≥ 98.0%), bovine serum albumin (BSA, purity ≥ 98.0%), chloroauric acid (HAuCl₄·3H₂O, purity ≥ 99.9%), and PEI (average M.W. 2500, purity ≥ 99.0%) were purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd. (Shanghai, China). Monoclonal antibody (Ab, 1 mg mL⁻¹, purified by protein G resin) against AFB₁ was provided by Dr. D. Wang. [43 (link)] The multiwalled CNTs (diameter: 20–40 nm, length: 1–2 μm, purity: > 95%) were purchased from Shenzhen Nanotech Port Co. Ltd. (Shenzhen, China), and were purified according to our previous work [44 (link)]. The hydrogel pellicles of bacterial celluloses were provided by Ms. C.Y. Zhong (Hainan Yeguo Foods Co., Ltd. Haikou, China). Wheat samples were bought from a local supermarket. All other inorganic chemicals and organic solvents were analytical reagents grade, purchased from China National Pharmaceutical Industry Co., Ltd. (Beijing, China), and used without further purification. All aqueous solutions and buffers were prepared with deionized water (resistance of 18.2 MΩ cm⁻¹) produced from a Millipore Q water purification system.

Bovine serum albumin (BSA), 3,3′5,5′-tetramethylbenzidine liquid substrate (TMB), and Aflatoxin B1, aflatoxin M1, aflatoxin B2, aflatoxin G1, aflatoxin G2, ochratoxin A (OTA), deoxynivalenol (DON), fumonisin B1 (FB1), and zearalenone (ZEA) standard solutions were purchased from Sigma Aldrich (Merck, Darmstadt, Germany). Methanol (HPLC grade), microplates and all other chemicals were obtained from VWR International (Milan, Italy). Rabbit polyclonal antibodies directed towards Aflatoxin B1 (anti-AFB1) and Aflatoxin B1 conjugated to horse radish peroxidase (AFB1-HRP) were prepared in the laboratory as described in [16 (link)]. Optical density at 450 nm was measured by a Multiskan microplate reader (ThermoScientific, Waltham, MA, USA). Extract were centrifuged in a refrigerated centrifuge (BR, Juan, France).