Pbad hisa vector

The gene encoding the N-terminal His-tagged l-AI (N-His-l-AI) was constructed by replacing the ATG (Adenosine, Thymine, and Guanosine) initiation codon of the araA gene from E. faecium DBFIQ E36 with the sequence CCATGGGTCATCATCATCATCACCAT, and the TAA codon with the sequence TAATAGAATTC. The first sequence provides an NcoI restriction site, the ATG codon, a GGT codon (coding for glycine in order to improve its translation) and 6 His codons. The second sequence provides an additional in-tandem stop codon and an EcoRI restriction site. The new codon-optimized chimeric araA gene containing these additional sequences was synthesized by ATG: Biosynthetics GmbH (Dusseldorf, Germany). The synthetic gene was cut with NcoI and EcoRI and cloned into the equivalent restriction sites of the pBAD/HisA vector (Invitrogen, Carlsbad, CA, USA) to generate the plasmid pBAD-ARA, arabinose inducible expression, which was transformed into E. coli DH10B cells by electroporation. The recombinant plasmid was sequenced to confirm the construction. The resulting recombinant N-His-l-AI contains 481 aa (amino acids) including the initial methionine (MW 55,036). The production of N-His-l-AI using the pBAD-ARA vector is controlled by the ParaC promoter, which is inducible by l-arabinose.

negGFP-human-SAM fusions and DNA used in cloning were as described previously [22 (link)]. All human ANKS3-SAM constructs contained residues 421–490 [UniProt:Q6ZW76] and all human ANKS6-SAM constructs contained residues 771–840 [UniProt:Q68DC2]. A His₆-tagged construct of ANKS3-SAM was generated by cloning the human ANKS3-SAM sequence into a pET28 vector (Novagen). A His₆-tagged construct of ANKS6-SAM was generated by cloning the ANKS6-SAM sequence into a pBAD-HisA vector (Invitrogen). In both constructs, the residues MARHHHHHHSSG were added to the N-terminus of each SAM to incorporate a His₆-tag. Hexahistidine small ubiquitin-like modifier (SUMO) tagged constructs were generated by cloning the ANKS3-SAM and ANKS6-SAM sequences into a pHis-SUMO vector [44 (link)]. Site-directed mutagenesis was performed using the Quickchange method (Agilent). All plasmid sequences were verified by DNA sequencing (Genewiz).