ChIP assays were performed essentially as described before22 ,26 (link),33 –44 . In brief, chromatin in control and treated cells were cross-linked with 1% formaldehyde. Cells were incubated in lysis buffer (150 mM NaCl, 25 mM Tris pH 7.5, 1% Triton X-100, 0.1% SDS, 0.5% deoxycholate) supplemented with protease inhibitor tablet and PMSF. DNA was fragmented into ~200 bp pieces using a Branson 250 sonicator. Aliquots of lysates containing 200 μg of protein were used for each immunoprecipitation reaction with anti-BRG1 (Santa Cruz, sc-10768), anti-Sp1 (Abcam, ab13370), anti-SRF (Cell Signaling Technology, 5147), (Santa Cruz, sc-585), anti-SLUG (Cell Signaling Technology, 9585), anti-ZEB1 (Cell Signaling Technology, 3396), anti-SNAIL (Cell Signaling Technology, 3879), anti-acetyl H3 (Millipore, 06-599), anti-acetyl H4 (Millipore, 06-598), anti-histone H3 (Millipore, 06-755), or pre-immune IgG. For re-ChIP, immune complexes were eluted with the elution buffer (1% SDS, 100 mM NaCO3), diluted with the re-ChIP buffer (1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris pH 8.1), and subject to immunoprecipitation with a second antibody of interest.
Anti acetyl h4
Manufactured by Merck Group
Sourced in Italy
Anti-acetyl H4 is a laboratory reagent used in the detection and analysis of acetylated histone H4 protein. It is a specific antibody that binds to the acetylated form of histone H4, allowing researchers to study epigenetic modifications and chromatin dynamics.
Automatically generated - may contain errors
Lab products found in correlation
Anti acetyl h3, by Merck Group (7 mentions)
250 sonicator, by Emerson (4 mentions)
Anti zeb1, by Cell Signaling Technology (2 mentions)
Anti brg1, by Santa Cruz Biotechnology (2 mentions)
Anti srf, by Cell Signaling Technology (2 mentions)
Anti snail, by Cell Signaling Technology (2 mentions)
Anti slug, by Cell Signaling Technology (2 mentions)
Anti trimethyl h3k4, by Merck Group (2 mentions)
Cfx96 cycler, by Bio-Rad (2 mentions)
Anti h3, by Abcam (2 mentions)
Anti histone h3, by Merck Group (1 mentions)
Anti sp1, by Abcam (1 mentions)
Sybr qpcr master mix, by Toyobo (1 mentions)
Protein a, by GE Healthcare (1 mentions)
Anti h3k36me3, by Abcam (1 mentions)
Anti myc, by BioLegend (1 mentions)
Accel ngs 2s plus dna library kit, by Integrated DNA Technologies (1 mentions)
Hiseq 2500 platform, by Illumina (1 mentions)
Anti ezh2, by Merck Group (1 mentions)
Anti tri methyl histone h3 lys27, by Cell Signaling Technology (1 mentions)
10 protocols using anti acetyl h4
1
Chromatin Immunoprecipitation (ChIP) Assay
2
Chromatin Immunoprecipitation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP protocol has been described previously [40 (link)] with antiacetyl H4 (Millipore, 06-866) antibody used. The samples were assessed by either PCR or RT-QPCR.
3
ChIP-qPCR for Histone Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) was carried out as previously described (32 (link)) with the oligonucleotides listed in Supplementary Table S2 . Thus, anti-H3 (1.0 μl; Abcam, 1791), anti-acetyl H4 (1.0 μl; Millipore, 06–598), anti-acetyl H3 (1.0 μl; Millipore, 06-599), or anti-trimethyl H3K4 (0.5 μl; Millipore, 07-473) was bound to Protein A (GE-Healthcare, 17078001) agarose beads. Binding for anti-acetyl H4, anti-acetyl H3 and anti-H3K4me3 or for anti-H3 was done overnight in FA lysis buffer containing 1 M NaCl or in FA lysis buffer with 275 mM NaCl, respectively. Precipitates were washed with the same buffer, once with FA lysis buffer containing 1.5 M NaCl for anti-acetyl H4, anti-acetyl H3 and anti-H3K4me3 or with FA lysis buffer containing 500 mM NaCl for anti-H3, once with 10 mM Tris–HCl (pH 8.0), 0.25 M LiCl, 1 mM EDTA, 0.5% NP-40, 0.5% sodium deoxycholate, and once with TE (10 mM Tris–HCl [pH 8.0], 1 mM EDTA). Precipitated DNAs were analyzed by real-time quantitative PCR using SYBR qPCR Master mix (TOYOBO, QPS-201T) and CFX96 cycler (Bio-Rad).
4
Chromatin Immunoprecipitation with Histone Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells fixed with 1% formaldehyde were subjected to ChIP as previously described6 (link) with oligonucleotides as listed in Supplementary Table 2 . The following histone antibodies were used: anti-H3K36me3 (Abcam ab9050), anti-acetyl H4 (Millipore 06–598), anti-acetyl H3 (Millipore 06–599), anti-myc (BioLegend 626802) and anti-H3 (Abcam ab1791). Except for H3 acetylation, all ChIP-seqs included S. pombe “spike-in” added at 10% relative to Saccharomyces cerevisiae chromatin.
Precipitated DNAs were analyzed by quantitative real-time PCR using THUNDERBIRD® SYPR qPCR Mix (TOYOBO) and CFX96 cycler (Bio-Rad). The DNA libraries for ChIP-seq were prepared using Accel-NGS 2 S Plus DNA Library Kit (Swift Biosciences) and sequenced on the HiSeq2500 platform (Illumina) following the manufacturer’s instructions.
Precipitated DNAs were analyzed by quantitative real-time PCR using THUNDERBIRD® SYPR qPCR Mix (TOYOBO) and CFX96 cycler (Bio-Rad). The DNA libraries for ChIP-seq were prepared using Accel-NGS 2 S Plus DNA Library Kit (Swift Biosciences) and sequenced on the HiSeq2500 platform (Illumina) following the manufacturer’s instructions.
5
Chromatin Immunoprecipitation Assay for Histone Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunoprecipitation of chromatin was performed according to the Upstate (Millipore) standard protocol. Briefly, 1.2 × 107 BMDMs were fixed using 1% formaldehyde for 10 min at 37 °C, harvested, and sonicated to generate chromatin fragments of 200–500 bp. Then 20 µg of sheared chromatin was immunoprecipitated overnight with 2 µg of anti-Tri-Methyl-Histone H3 (Lys27) (Cell Signaling; 97335), anti-acetyl-H4 (Millipore; 06–866) or anti-EZH2 (Millipore; CS203195) antibody. Immunocomplexes were recovered using 20 µl of protein G magnetic beads, washed, and eluted. Cross-linking was reversed at 65 °C 4 h and immunoprecipitated DNA was recovered using the PCR purification kit from Qiagen. Genomic regions of interest were identified by real-time quantitative PCR (qPCR) using SYBR Green Master Mix (Invitrogen). Each value was corrected by the corresponding input chromatin sample. CXCL9 promoter was amplified using “CCCCGTTGCAATACTTTCAT” (forward) and “CCCCGTTGCAATACTTTCAT” (reverse) primers (EZH2, acetyl-H4) or “TGCTGTTGAATGCCACTTTC” (forward) and “TCCCTGCTACCTTTTCCAGA” (reverse) primers (H3me3). Mouse GAPDH promoter (Diagenode) was amplified as a control.
6
ChIP Assay Protocol for Epigenetic Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed essentially as described before [[29] , [30] , [31] , [32] , [33] , [34] , [35] (link)]. Briefly, chromatin in control and treated cells were cross-linked with 1% formaldehyde. Cells were incubated in lysis buffer (150 mM NaCl, 25 mM Tris pH 7.5, 1% Triton X-100, 0.1% SDS, 0.5% deoxycholate) supplemented with protease inhibitor tablet and PMSF. DNA was fragmented into ~500 bp pieces using a Branson 250 sonicator. Aliquots of lysates containing 200 μg of protein were used for each immunoprecipitation reaction with anti-acetyl H3 (06-599, Millipore), anti-acetyl H4 (06-598, Millipore), anti-acetyl H3K27 (17-683, Millipore), anti-H4K16 (13534, Cell Signaling), anti-p300 (sc-585, Santa Cruz), anti-SRF (5147, Cell Signaling), and anti-KAT8 (13842-1, Proteintech) antibodies. Precipitated genomic DNA was amplified by real-time PCR with primers that span the target promoters or a control promoter (GAPDH). Serially diluted genomic DNA extracted from normal cells/tissues was used to generate a standard curve to calculate the amount of DNA being precipitated by a particular antibody. A total of 10% of the starting material is also included as the input. Data are then normalized to the input and expressed as fold changes compared to the control group. All experiments were repeated at least three times.
7
ChIP-based Analysis of Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin Immunoprecipitation (ChIP) assays were performed essentially as described before (Wang et al., 2020 (link); Liu et al., 2021a (link)). In brief, chromatin in control and treated cells were cross-linked with 1% formaldehyde. Cells were incubated in lysis buffer (150 mM NaCl, 25 mM Tris pH 7.5, 1% Triton X-100, 0.1% SDS, 0.5% deoxycholate) supplemented with protease inhibitor tablet and PMSF. DNA was fragmented into ∼200 bp pieces using a Branson 250 sonicator. Aliquots of lysates containing 200 μg of protein were used for each immunoprecipitation reaction with anti-Twist1 (Proteintech, 25465-1), anti-Slug (Cell Signaling Technology, 9585), anti-Zeb1 (Cell Signaling Technology, 3396), anti-Snail (Cell Signaling Technology, 3879), anti-anti-acetyl H3 (Millipore, 06-599), anti-acetyl H4 (Millipore, 06-598), anti-HDAC1 (Santa Cruz, sc-7872), or pre-immune IgG. For re-ChIP, immune complexes were eluted with the elution buffer (1% SDS, 100 mM NaCO3), diluted with the re-ChIP buffer (1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris pH 8.1), and subject to immunoprecipitation with a second antibody of interest.
8
ChIP Assay for Hes5, SIRT1, and Histone Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) assays were performed essentially as described before [57 (link), 73 (link)–90 ]. In brief, chromatin in control and treated cells were cross-linked with 1% formaldehyde. Cells were incubated in lysis buffer (150 mM NaCl, 25 mM Tris pH 7.5, 1% Triton X-100, 0.1% SDS, 0.5% deoxycholate) supplemented with protease inhibitor tablet and PMSF. DNA was fragmented into ~200 bp pieces using a Branson 250 sonicator. Aliquots of lysates containing 200 μg of protein were used for each immunoprecipitation reaction with anti-Hes5 (Abcam, ab194111), anti-SIRT1 (Santa Cruz, sc-74504), anti-acetyl H3 (Millipore, 06-599), anti-acetyl H4 (Millipore, 06-866), or pre-immune IgG. Precipitated DNA was amplified with the following primers: #1, 5’-AGAGTGAGACAGGGCCAAGAC-3’ and 5’-AAACCGAAATTGCTCAACACAC-3’; #2, 5’-AAACCCACAACGTATTA-3’ and 5’-ATGCAGCAATGAACAAC-3’.
9
Chromatin Immunoprecipitation and Re-ChIP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP and Re-ChIP assays were performed essentially as described before (29 (link)). Aliquots of lysates containing 200 μg of protein were used for each immunoprecipitation reaction with anti-MRTF-A (Santa Cruz, SC-32909), anti-BRG1 (Santa Cruz, SC-10768), anti-BRM (Santa Cruz, SC-6450), anti-acetyl H3 (Millipore, 06–599), anti-acetyl H4 (Millipore, 06-598), anti-dimethyl (Millipore, 07-030), anti-trimethyl H3K4 (Millipore, 07-473), anti-ASH2 (Bethyl Laboratories, A300-489A) or pre-immune IgG. Precipitated genomic DNA was amplified by real-time PCR with primers listed in Supplementary Table S1.
10
Western Blot Analysis of Hippocampus Acetylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blot analysis was performed as previously described [43 (link)]. Briefly, isolated hippocampus tissue was homogenized by using ice-cold RIPA buffer (15m mM NaCl, 5 mM Tris HCl, pH 7.4, 5 mM Ethylenediaminetetraacetic Acid (EDTA), 1% Triton X-100, 1% sodium deoxycholate, and 0.1% SDS) with Protease Inhibitor Cocktail (Sigma-Aldrich, Milan, Italy). Equal amounts of proteins (5 μg) were separated on SDS-PAGE gels and blotted to PVDF membranes (GE Healthcare, purchased by Euroclone). After being saturated in 5% milk in Tris Buffer Saline-Tween 20 (TBS-T), membranes were incubated with anti-acetyl H3 (1:2000 Millipore, purchased by Euroclone), anti-acetyl H4 (1:2000 Millipore, purchased by Euroclone) or anti-β-actin (1:20,000, mouse monoclonal, Sigma-Aldrich, Milan, Italy) antibodies. Membranes were extensively washed with TBS-T and then incubated with peroxidase-conjugated secondary antirabbit (1:3000, Sigma-Aldrich, Milan Italy) or with the fluorescent IRDye secondary anti-mouse antibody (LI-COR, purchased from Carlo Erba Reagents, Milan, Italy). Peroxidase immunoreactivity bands were revealed by chemiluminescence using ECL detection system (Biorad, Milan, Itay). Chemiluminescence and fluorescence membrane signals were scanned and quantified in an Odyssey LI-COR scanner (LI-COR, purchased by Carlo Erba Reagents Milan, Italy).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!