The largest database of trusted experimental protocols

Sybr premix

Manufactured by Transgene

SYBR Premix is a ready-to-use solution designed for real-time PCR applications. It contains SYBR Green I, a fluorescent dye that binds to double-stranded DNA, and all the necessary components for PCR amplification.

Automatically generated - may contain errors

2 protocols using sybr premix

1

Real-Time PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Bio-Rad Real-time PCR system CFX96 and SYBR Premix (TranStart Green qPCR SuperMix, TransGen Biotech) were used to quantify gene expression. Total RNA extraction (EasyPure Plant RNA Kit, TransGen Biotech) and qRT-PCR were carried out according to the RNA extraction and SYBR Premix instructions, respectively. The specific primer pairs used are listed in Supplementary Table 2. Data were analyzed by the Livak method (Livak and Schmittgen, 2001 (link)) and expressed as a normalized relative expression level (2-ΔΔCT) of the respective genes, and the relative transcript level of each sample was normalized to actin (Supplementary Table 2). Six biological replicates were included in the experiment. The IBM SPSS version 21 software was used for statistical analysis, the p value was determined using Fisher’s protected LSD test.
+ Open protocol
+ Expand
2

Quantitative Analysis of Adipogenesis Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cell samples using TRIzol Reagent (Invitrogen) and quantified using the NanoDrop 2000 spectrophotometer (Thermo Scientific, Bremen, Germany). The first strand of cDNA was synthesized using M-MLV reverse transcriptase (Invitrogen) according to the manufacturer’s instruction. Oligo (dT) was used as the primers for reverse transcription of mRNA. Stem-loop RT primers were used for the reverse transcription of miRNAs. Actin and U6 were used as their respective controls. Semi-quantitative PCR and real-time quantitative PCR were performed in ABI PCR machines using pre-stained mix (Tiangen) and SYBR Premix (TransGen Biotech) respectively. The primers used for reverse transcription and RT-PCR were listed in Table 1.

Primers used for reverse transcription and RT-PCR.

NameSequences
FABP4-FACTGGGCCAGGAATTTGACG
FABP4-RCTCGTGGAAGTGACGCCTT
PPARγ-FGCTGACCAAAGCAAAGGCG
PPARγ-RGCCCTGAAAGATGCGGATG
LPL-FTCATTCCCGGAGTAGCAGAGT
LPL-RGGCCACAAGTTTTGGCACC
PLIN1-FGCGAGGATGGCAGTCAACAAA
PLIN1-RGCACGCCCTTCTCATAGGCAT
Actin-FCATGTACGTTGCTATCCAGGC
Actin-RCTCCTTAATGTCACGCACGAT
miR-301b-RTGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCTTTGA
miR-130b-RTGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATGCCCT
miR-301b-UpGCGGCGCAGTGCAATGATATT
miR-130b-UpGTCGTGCAGTGCAATGATGAAA
miRNA-DnTCCAGTGCAGGGTCCGAGGT
U6-RTAAAATATGGAACGCTTCACGAA
U6-UpCTCGCTTCGGCAGCACATATA
U6-DnACGCTTCACGAATTTGCGTGTC
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!