Hs actb 1 sg quantitect primer assay
The Hs_ACTB_1_SG QuantiTect Primer Assay is a pre-designed primer and probe set for the quantitative detection of the ACTB gene in human samples. The assay is optimized for use with QuantiTect Probe RT-PCR Kits.
Lab products found in correlation
3 protocols using hs actb 1 sg quantitect primer assay
Molecular Profiling of Melanogenesis
TCF7L2 Gene Expression Analysis
Quantification of ANPCII, lncRNA-RP11, and miR106b-5p
ANPCII mRNA and lncRNA-RP11-175K6 expressions in sera samples were quantified by using QuantiTect SYBR Green PCR Kit and RT2 SYBR Green ROX qPCR Mastermix, sequentially. RT2 lncRNA qPCR Assay for Human lncRNA-RP11-175K6.1(LOC101927740 (ENST00000499 583) and ANPCII QuantiTect Primer Assay (NM_ 001002244), Hs_ACTB_1_SG QuantiTect Primer Assay (NM_001002244) [that was used as housekeeping gene in equalization of raw data] were purchased from Qiagen, Germany.
We used miScript SYBR Green PCR Kit (Qiagen /SABiosciences Corporation, Frederick, MD) for quantification of hsa-_ miR106b-5p expression in different sera samples using either Hs_ miR106_1 miScript Primer Assay targets mature miRNA: hsa- miR106 - MIMAT0000680: 5'UAAAGUGCUGACAGUGCAGAU and snord68 that was used as housekeeping gene, Each reaction was done in duplicate. Relative quantification of RNAs expression was calculated by using the method of Leviak RQ= 2-ΔΔCt method [19 (link)].
Data analysis was performed using the Rotor Gene real time PCR (Qiagen, Hilden, Germany) which is considered negative if higher than 36 Ct value.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!