Anti-MITF (C5), anti-EDNRB (EPR7013), anti-CREB (48H2), anti-phospho-CREB (87G3), anti-β-actin (AC-15), anti-rabbit IgG HRP-conjugated and H89 dihydrochloride were purchased from Abcam (Cambridge, MA). Anti-mouse IgG HRP-conjugated was purchased from Jackson ImmunoResearch (West Grove, PA). Antibodies for MAPK and phosphorylated MAPK, the MAPK family sampler kit and the phospho-MAPK family sampler kit were purchased from Cell Signaling Technology (Beverly, MA). Antibodies for MSK1 (C27B2) and phosphorylated (S376 and T581) MSK1 were purchased from Cell Signaling Technology. For Real-time RT-PCR, primers for β-actin (Hs_ACTB_1_SG Quantitect Primer Assay; QT00095431), EDNRB (Hs_EDNRB_1_SG Quantitect Primer Assay; QT00014343) and MITF (Hs_MITF_1_SG Quantitect Primer Assay; QT00037737) were purchased from Qiagen (Hilden, Germany). PBE (Flavangenol) which obtained by hot water extraction method from French maritime pine (Pinus pinaster) bark was supplied by Toyo Shinyaku (Saga, Japan).
Hs actb 1 sg quantitect primer assay
Manufactured by Qiagen
Sourced in Germany
The Hs_ACTB_1_SG QuantiTect Primer Assay is a pre-designed primer and probe set for the quantitative detection of the ACTB gene in human samples. The assay is optimized for use with QuantiTect Probe RT-PCR Kits.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using hs actb 1 sg quantitect primer assay
1
Molecular Profiling of Melanogenesis
2
TCF7L2 Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR (reverse transcription polymerase chain reaction) was subsequently conducted for synthesizing complementary Deoxyribonucleic acid (cDNA) of the samples, using a commercial QuantiTect Reverse Transcription Kit (Qiagen). The obtained cDNA was stored at -20°C until the moment of quantification, which was also performed in NanoDrop spectrophotometer (Thermo Scientific), with a ratio of ~1.8 for assessment of purity. β-actin was used as housekeeping gene, or an endogenous reference gene to normalize the expression. The primer sequence of TCF7L2 for qPCR was: sense– 5’-CACAC TTACC AGCCG ACGTA-3’ , antisense– 5’-TCCTG TCGTG ATTGG GTACA-3’ . For β-actin, the Hs_ACTB_1_SG QuantiTect Primer Assay (NM_001101) (Qiagen) was used.
3
Quantification of ANPCII, lncRNA-RP11, and miR106b-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
ANPCII mRNA and lncRNA-RP11-175K6 expressions in sera samples were quantified by using QuantiTect SYBR Green PCR Kit and RT2 SYBR Green ROX qPCR Mastermix, sequentially. RT2 lncRNA qPCR Assay for Human lncRNA-RP11-175K6.1(LOC101927740 (ENST00000499 583) and ANPCII QuantiTect Primer Assay (NM_ 001002244), Hs_ACTB_1_SG QuantiTect Primer Assay (NM_001002244) [that was used as housekeeping gene in equalization of raw data] were purchased from Qiagen, Germany.
We used miScript SYBR Green PCR Kit (Qiagen /SABiosciences Corporation, Frederick, MD) for quantification of hsa-_ miR106b-5p expression in different sera samples using either Hs_ miR106_1 miScript Primer Assay targets mature miRNA: hsa- miR106 - MIMAT0000680: 5'UAAAGUGCUGACAGUGCAGAU and snord68 that was used as housekeeping gene, Each reaction was done in duplicate. Relative quantification of RNAs expression was calculated by using the method of Leviak RQ= 2-ΔΔCt method [19 (link)].
Data analysis was performed using the Rotor Gene real time PCR (Qiagen, Hilden, Germany) which is considered negative if higher than 36 Ct value.
+ Expand
ANPCII mRNA and lncRNA-RP11-175K6 expressions in sera samples were quantified by using QuantiTect SYBR Green PCR Kit and RT2 SYBR Green ROX qPCR Mastermix, sequentially. RT2 lncRNA qPCR Assay for Human lncRNA-RP11-175K6.1(LOC101927740 (ENST00000499 583) and ANPCII QuantiTect Primer Assay (NM_ 001002244), Hs_ACTB_1_SG QuantiTect Primer Assay (NM_001002244) [that was used as housekeeping gene in equalization of raw data] were purchased from Qiagen, Germany.
We used miScript SYBR Green PCR Kit (Qiagen /SABiosciences Corporation, Frederick, MD) for quantification of hsa-_ miR106b-5p expression in different sera samples using either Hs_ miR106_1 miScript Primer Assay targets mature miRNA: hsa- miR106 - MIMAT0000680: 5'UAAAGUGCUGACAGUGCAGAU and snord68 that was used as housekeeping gene, Each reaction was done in duplicate. Relative quantification of RNAs expression was calculated by using the method of Leviak RQ= 2-ΔΔCt method [19 (link)].
Data analysis was performed using the Rotor Gene real time PCR (Qiagen, Hilden, Germany) which is considered negative if higher than 36 Ct value.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!