Total RNA was extracted from cells with Trizol reagent (Sigma). cDNA was prepared with a reverse-transcriptase M-MLV kit (Takara). Real-time PCR was performed on a CFX-96 machine (Bio-Rad) with SYBR Green Master Mix (DBI Bioscience). The housekeeping gene 18S rRNA was used for normalization. Primer sequences are listed in Supplementary Table S1 . The EMSA was performed as previously described (Oestreich et al, 2008 (link)). For EMSA, nuclear extracts were prepared from wild-type, SKAP55−/−, or ADAP−/− CTLs. Biotin-labeled double-stranded NFATc1 binding DNA probe N1 (5′-GCTTGGTGGGGAAGGAAACATTACTTTGAA-3′) was incubated with 5 μg nuclear extract for 30 min in 20 μl reaction buffer containing 100 ng double-stranded poly(dI:dC) and 50 mM DTT. For competition experiments, nuclear extracts were pre-incubated for 20 min with a 100-fold molar excess of the unlabeled competitor probe (Comp. N1) or the mutant probe that contains the same sequence except for carrying a mutated NFAT-binding site (Comp. mutN1). The protein–DNA complex was separated by electrophoresis (6% nondenaturing TBE gels) and detected by a Chemiluminescent EMSA kit (Beyotime).
Sybr green master mix
Manufactured by DBI Bioscience
Sourced in Germany, China, United States
SYBR Green master mix is a ready-to-use solution designed for real-time PCR applications. It contains SYBR Green I dye, which binds to double-stranded DNA, and all necessary reagents for PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Cfx96 machine, by Bio-Rad (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
M mlv reverse transcriptase kit, by Takara Bio (2 mentions)
Trizol reagent, by Tiangen Biotech (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Chemiluminescent emsa kit, by Beyotime (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
M mlv transcriptase, by Promega (1 mentions)
Abi stepone pcr system, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Rnase free dnase 1, by Thermo Fisher Scientific (1 mentions)
Reverse transcription system, by Promega (1 mentions)
M mlv reverse transcriptase, by Takara Bio (1 mentions)
Steponeplus system, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcription, by Takara Bio (1 mentions)
Reverse transcriptase m mlv rnase h, by Takara Bio (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
9 protocols using sybr green master mix
1
Gene Expression Analysis Protocol
2
Quantifying Cytokine Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative mRNA expression levels of TGF-β1, M-CSF, G-CSF, GM-CSF, IL-6, TNF-α, IL-10, and IL-4 were measured by qRT-PCR. Total RNA was extracted from cells or tissues with TRIzol reagent, and complementary DNA was generated using a Reverse Transcriptase M-MLV kit (Takara). Relative qRT-PCR was performed on a CFX-96 machine (Bio-Rad) with SYBR Green Master Mix (DBI Bioscience).
3
Quantitative RT-PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAiso Plus (Takara) was used to extract total cellular RNA, which was reverse-transcribed into cDNA with M-MLV transcriptase (Promega). Quantitative RT-PCR was performed on an ABI StepOne PCR System (Applied Biosystems) with SYBR Green Master Mix (DBI Bioscience), with an initial denaturation of 95°C for 10 min, and followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. GAPDH was used as an internal control. Primer sequences are listed in Table S1 .
4
Transcriptional Analysis of CRISPR-Cas Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The bacteria were grown to the logarithmic phase, and RNA was isolated using the E.Z.N.A. bacterial RNA isolation kit (Omega, Beijing, China) according to the manufacturer's instructions. Contaminated DNA was removed from the samples with RNase-free DNase I (Thermo Scientific, Waltham, MA, USA), and cDNA synthesis was performed using the Reverse Transcription System (Promega, Madison, WI, USA) according to the manufacturer's instructions. Quantitative real-time reverse transcription-PCR (RT-qPCR) was performed to determine the transcription levels of the cas genes using SYBR Green MasterMix (DBI Bioscience, Ludwigshafen, Germany) and gene-specific primers (Table 2 ), and the data were normalized with the housekeeping gene tmRNA transcript. The relative fold change was calculated using the threshold cycle (2−ΔΔCT) method.
5
Quantification of Cytokines and VEGF in PBMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from PBMCs using TRIzol Reagent (DP405, TIANGEN), then converted to cDNA using M-MLV reverse transcriptase (2641A, TAKARA). Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) was performed on a CFX-96 machine (Bio-rad) using SYBR Green master mix (DBI Bioscience). Values were normalized for β-actin mRNA levels. The average mRNA levels of IL-6, IL-1β and VEGF-C in PBMCs from healthy subjects were set as 1.00 and those from PAS patients were calculated as the fold change.
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polysome-associated RNA and total RNA were extracted using TRIZOL reagent (Life Technologies, Carlsbad, USA) and cDNA was synthesized with SuperScript III (Life Technologies, Carlsbad, USA). Real-time quantitative PCR (RT-qPCR) was conducted in triplicates (i.e., three mice per group that were different from those used in RNA-seq experiments) with a SYBR Green MasterMix (DBI Bioscience, Shanghai, China) following the manufacturer's instructions. The Applied Biosystems StepOnePlus system (Applied Biosystems, Foster City, USA) was employed to generate a threshold cycle (Ct), as per the manufacturer's protocol. ΔΔCt method was used to compute gene expression values, using Actb as the reference. The primer sequences were synthesized by Sangon Biotech (Shanghai, China) and obtained from PrimerBank [41 (link)].
7
Overexpression of DOCK8 and LRCH1 in T cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flag-tagged human DOCK8 (WT or pri mutation) were subcloned into the retroviral vector pMX-IRES-GFP; HA-tagged human LRCH1 was subcloned into the MIGR-IRES-GFP vector. These plasmids were transfected to 293T cells using the reagent pCL-10A, and the retroviral supernatants were collected to infect T8.1 cells, followed by sorting of GFP+ cells. Total RNA was isolated from cells or tissues using TRIzol Reagent (TIANGEN), and converted to cDNA using M-MLV reverse transcription (Takara Bio Inc.). Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed on a CFX-96 machine (Bio-Rad Laboratories) using SYBR Green master mix (DBI Bioscience).
8
Quantifying KLF2 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by RNAiso Plus reagent according to the manufacturer's instructions (Takara Bio, Mountain View, CA, USA). First‐strand cDNA was generated using M‐MLV reverse transcriptase (RNase H‐) (Takara Bio). Samples were amplified by a CFX‐96 machine (Bio‐Rad, Hercules, CA, USA) using SYBR Green master mix (DBI Bioscience, Shanghai, China) according to the manufacturer's instructions, and data were normalized to the 18S rRNA control. The qRT‐PCR primers were as follows: human KLF2: forward, 5′‐TGCGTTCTATTACCCCGAAC‐3′; reverse, 5′‐CAGCAGAAAGCGGCCGTGCA‐3′; and human 18S: forward, 5′‐GAGAAACGGCTACCACATCC‐3′; and reverse, 5′‐CACCAGACTTGCCCTCCA‐3′.
9
Quantitative PCR analysis of PPM1A-AS in T-ALL
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of T-ALL cells was extracted with TRIzol Reagent (Thermo Fisher Scientific, MA, USA) and 1ug total RNA was reverse-transcribed into complementary DNA(cDNA) using the RevertAid First Strand cDNA Synthesis Kit (Thermo). Quantitative real-time PCR was performed to determine the RNA expression using SYBR Green master mix (DBI®Bioscience, Ludwigshafen, German) with specific primers listed below. All of the reactions were run in triplicate and the relative levels of lncRNA were normalized to 18S rRNA. The sequences of the primers were as follows: hGAPDH Forward: 5’- CTTTTGCGTCGCCAGCCGAG -3’; hGAPDH Reverse: 5’- CCAGGCGCCCAATACGACCA -3’; PPM1A-AS Forward: 5’- AGTCCTGGACAGTCTTTAGGC -3’; PPM1A-AS Reverse: 5’- AGGTGTGTGCTGGGAAATGT -3’.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!