Microsoft excel

Total RNA was isolated after treatments using TRIzol reagent (Invitrogen) and treated with a DNA-free kit (Ambion, Austin, TX) to eliminate genomic DNA contamination. Quantitative RT/PCR analyses were performed according to standard protocols using iQ Sybergreen Supermix using the primers; geminin: forward 5′- CGGGATCCATGAATCCCAGTATGAAGCAGAAACAAGAA-3′ and reverse 5′- ACGCGTCGACTCATATACATGGCTTTGCATCCGTA, c-Abl: forward 5′-GATACGAAGGGAGGGTGTACCA-3′, reverse 5′-CTCGGCCAGGGTGTTGAA-3′, GAPDH: forward 5′-GGACCTGACCTGCCGTCTAG-3′ and reverse 5′-TGGTGCTCAGTGTAGCCCAG-3′. GAPDH are common sequences adopted from public literature. Triplicate C_T values were analyzed in Microsoft Excel using the comparative C_T (ΔΔC_T) method as described by the manufacturer (Applied Biosystems). The amount of target (2^-ΔΔCT) was obtained by normalization to an endogenous reference (GAPDH RNA) and relative to a calibrator.

According to the manufacturer's instructions, total RNA was extracted from cells and tissues using TRIzol reagent (Sigma Chemical, St Louis, MO, USA) [31 (link)]. The relative abundance of mRNA was calculated by normalizing to GAPDH mRNA. The values from three independent RT-PCR data were used for statistical analyses. One microgram of RNA was used for reverse transcription into cDNA using the First-Strand Synthesis Kit (Roche, Indianapolis, IN, USA). The cDNAs were then diluted and used for real-time PCR with specific probes using Master Mix (Roche) in an ABI7500 detection system (Applied Biosystems, Foster City, CA, USA). Triplicate CT values were analyzed in Microsoft Excel using the comparative CT(CT) method as described by the manufacturer (Applied Biosystems, Foster City, CA). The amount of target (2CT) was obtained by normalization to an endogenous reference (GAPDH) and relative to a calibrator. The probes for real-time PCR were purchased from Applied Biosystems.