The largest database of trusted experimental protocols

Sybr green 2 master mix

Manufactured by Thermo Fisher Scientific
Sourced in United States

SYBR green 2× Master Mix is a ready-to-use solution for real-time quantitative PCR (qPCR) analysis. It contains SYBR Green I dye, optimized PCR buffer, and DNA polymerase.

Automatically generated - may contain errors

8 protocols using sybr green 2 master mix

1

Kras Expression Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was harvested using the Qiagen RNeasy minikit (no. 74104), and 1 µg was reverse-transcribed to cDNA using the SuperScript III kit (ThermoFisher, 18080-051). qPCR was run on a ABI 7500 machine using the fast two-step program with dissociation curve and SYBR Green 2× master mix (ThermoFisher, 4309155). Transgenic and endogenous Kras expression was normalized to TBP. The primer sequences used were mKrasG12-1F (GCTTATCGATACCGTCGATCG), mKrasG12-1R (GGTCGTACTCATCCACAAAGTG), mKras-wt-2F (GAGCAAAGATGGGAAGAAGA), mKras-wt-2R (TTTGCACGAACAGAAGAAAAA), m TBP F (ACATCTCAGCAACCCACACA), and m TBP R (CAGCCAAGATTCACGGTAGA).
+ Open protocol
+ Expand
2

Quantitative Analysis of Kcnk18 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Reverse transcription was performed with Maxima Reverse Transcriptase (Thermo Fisher Scientific) and random hexamer primers. 50 ng cDNA was used for Real-time qPCR with SYBR Green 2× Master Mix (Thermo Fisher Scientific). Therefore, 1 µM of each primer (mouse samples: mKcnk18fwd_qPCR and mKcnk18rev_qPCR; human samples: Hs_KCNK18_1_SG QuantiTect Primer Assay, Qiagen) or 1 µM housekeeping primer for the respective control (mouse samples: 18s-fwd and 18s-rev; human samples: pbgd-fwd and pbgd-rev), 10 µL SYBR Green Master mix, and 50 ng cDNA were mixed. PCR was performed on a Step-One-Plus Real-Time PCR System (Applied Biosystems) with the following steps: hold 2 min 50 °C, initial denaturation 10 min 95 °C, amplification (50×) 10 s 95 °C—45 s 58 °C—1 min 72 °C. Data were analyzed with StepOne software (Applied Biosystems, v2.1) calculating δCT values and n-fold expression.
+ Open protocol
+ Expand
3

Phage Quantification by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Infective phagemid-containing phage particles and M13KO7 helper phage were quantified by spot titration of a tenfold dilution series of regular phage preparations. Total phage titers were determined by qPCR, as described by Peng et al. [37 (link)]. Therefore, 1000-fold diluted phage particles were pre-treated with DpnI for 10 min to remove residual cellular DNA. After incubation at 100 °C for 15 min, phage ssDNA was quantified by 40 cycles of qPCR (three biological and six technical replicates) in the presence of pDST32- or M13KO7-specific primers (Table S4) and SYBR Green 2× Master Mix (ThermoFisher Scientific, Waltham, MA, USA) in a QuantStudio3 real-time PCR-machine (ThermoFisher Scientific). A tenfold dilution series of pDST32-FTO (5613 bp) and M13KO7 dsDNA (8669 bp), ranging from 1 fg/μL to 107 fg/μL, was used as standard for the calibration curve of pDST32 and M13KO7 samples, respectively. The phage standard DNA concentration was converted to genome copies per microliter (gc/μL) according to the formula of Peng et al. [37 (link)].
+ Open protocol
+ Expand
4

Quantitative RT-PCR Inhibition Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Superscript III First Strand Synthesis System, Ultrapure Glycogen, UltraPure Agarose and
Trackit 100 BP DNA ladder were purchased from Invitrogen (Carlsbad, USA). TRizol Reagent
and Turbo DNA–free 50 reactions were from Ambion (Austin, USA). Alien QRT-PCR Inhibitor
Alert was purchased from Integrated Sciences Pty (Sydney, Australia). (R)-MG132,
BAY-11–7085 and Phorbol Myristate Acetate (PMA) were obtained from Cayman Chemical Company
(Michigan, USA). 8-Bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP), PCR primers,
Progesterone and Estradiol were purchased from Sigma (St Louis, USA). The 2 ml 2.8 mm
CK28-R Ceramic Bead Kit was acquired from Bertin Technologies (Montigny-le-Bretonneux,
France). L-Glutamine, Sodium Pyruvate, Gentamicin, HEPES, Dulbecco’s Modified Eagle Medium
(DMEM) and Charcoal Stripped Fetal Bovine Serum were obtained from Gibco (Carlsbad, USA).
SYBR Green 2× Master mix was from Applied Biosystems (Carlsbad, USA).
+ Open protocol
+ Expand
5

Quantitative Reverse Transcription PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
RT-qPCR was performed as previously described [59 (link),60 (link)]. Total RNA was prepared using an RNeasy RNA purification system (Qiagen, Hilden, Germany) with DNase I treatment. cDNA was synthesized using an RT kit for RT-qPCR (Qiagen) with a mixture of oligo dT and random primers. The cDNA pool was diluted 5- to 20-fold. The cDNA standard with permissible slopes of PCR efficiencies was prepared by step dilution of the cDNA pool for the relative quantification of mRNA levels. In 20 µL of qPCR mix, 0.25 µM of each primer, 4–10 µL of diluted cDNA, and 10 µL SYBR green 2× Master Mix (Applied Biosystems, Waltham, MA) were added and reacted at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Dissociation curves with specific single-peaked PCR and proper amplification slopes for PCR efficiency were confirmed. LinRegPCR software was used for baseline fluorescence correction, and for the calculation of Cq values and PCR efficiency of amplicons [61 (link)]. Primer sequences are listed in Supplementary Materials Table S3.
+ Open protocol
+ Expand
6

Transcriptional Analysis of Bacterial Stress Response

Check if the same lab product or an alternative is used in the 5 most similar protocols
Overnight cultures (16 to 18 h) of FSL S5-0395 grown in LB broth were subcultured 1:1,000 into LB or N-salts minimal medium (either pH 7 or pH 5.8), and subcultured samples were grown at 37°C with shaking at 200 rpm until cells reached mid-exponential phase (3 h for LB broth, 5 h for N-salts minimal medium). RNA was stabilized with RNA protect (Qiagen) and was collected using the RNeasy kit (Qiagen). DNA was depleted with Ambion DNase I (Life Technologies), and DNA depletion was confirmed with quantitative PCR (qPCR); a cycle threshold (CT) of 34 for rpoB in DNase-treated RNA samples was used for judging successful DNA depletion. cDNA libraries were prepared with the Superscript reverse transcription kit (Thermo Fisher), according to manufacturer’s instructions. qPCR was performed with SYBR green 2× master mix (Applied Biosystems) in a reaction mixture containing 0.4 μM each primer (see Table S7) and 1 µl of cDNA (approximately 15 ng of cDNA) as the template. Fold expression was calculated by raising the ΔΔCT to the power of the efficiency calculated for each primer pair (70 (link)). Results are the averages from three independent experiments, each performed in technical duplicates.
+ Open protocol
+ Expand
7

Quantitative RT-PCR Protocol for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
qRT-PCR was performed as previously described [40 (link),42 (link)]. Total RNA was prepared with DNase I treatment using RNeasy (Qiagen, Hilden, Germany). cDNA was synthesized using QuantiTect kit (Qiagen), a mixture of oligo dT and random primers, then diluted 5-fold in 10 mM Tris-Cl and 0.1 mM EDTA buffer. A step dilution of the cDNA pool was prepared as a standard for relative expression. cDNA (4–10 µL), 0.25 µM of each primer, and 10 µL SYBR green 2× Master Mix (Applied Biosystems, Waltham, MA, USA) were mixed and filled up to a 20 µL of a reaction mixture. We designed and used primer pairs (Table 1). We validated the primer pairs by melting curve analysis of single amplicons, amplification efficiencies, band size in agarose gel electrophoresis, and DNA sequencing of PCR products. Initial denaturation was performed at 95 °C 10 min, and 40 cycles of PCR were run at 95 °C for 15 sec and at 60 °C for 1 min. Relative mRNA expression levels were obtained as compared with the standard described above.
+ Open protocol
+ Expand
8

Quantifying Cucumber Virus Response

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from mock control and CMV‐inoculated cucumber leaf samples using TRIzol. One microgram of total RNA was treated with DNase (Thermo Fisher Scientific) according to the manufacturer's instructions. First‐strand cDNA synthesis was performed using the qPCRBIO cDNA synthesis kit (PCR Biosystems). Quantitative PCR was performed using 2.5 µl of diluted cDNA, 7.5 µl of SYBR green 2× master mix (Applied Biosystems) and 1 µl of forward and reverse primer (3 µM each), in a final volume of 15 µl of reaction mixture in a StepOne Real‐Time system (Applied Biosystems). The reaction conditions included denaturation at 94 ℃ for 20 s, followed by 40 cycles of 94 ℃ for 3 s and 60 ℃ for 30 s. The host EF‐1α gene was used as an internal control for cDNA normalization. For each replicate, total RNA was extracted from pooled samples of three test plants. Relative expression was quantified using the 2−ΔΔCt method. Three biological replicate leaf discs (50 mg fresh weight) were taken for analysis and each sample was a pool of three plants.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!