Quantitect sybr green 1 pcr kits

Total RNA was isolated with Trizol reagent (Invitrogen), and reverse transcription was performed with the Omniscript RT kit (QIAGEN, Mississauga, ON, Canada). mRNA expression levels were measured by real-time PCR in a Rotor Gene 3000 Real Time DNA Detection System (Montreal Biotech, Kirkland, QC, Canada) with QuantiTect SYBR Green I PCR kits (QIAGEN) as described (Makui et al., 2005 (link)). The following primers were used: hepcidin - (F) CTCTGCAAGTTGTCCCGTCT and (R) ACCAGAGCAAGCTCAAGACC; β-Actin - (F) AGAAAATCTGGCACCACACC and (R) AGAGGCGTACAGGGATAGCA.

Total RNA was isolated with Trizol reagent (Invitrogen, Burlington, ON), and reverse transcription was performed with the Omniscript RT kit (QIAGEN, Mississauga, ON). mRNA expression levels were measured by real-time PCR in a Rotor Gene 3000 Real Time DNA Detection System (Montreal Biotech, Kirkland, QC) with QuantiTect SYBRGreen I PCR kits (QIAGEN, Mississauga, ON) as previously described^{53 (link)}. Expression levels were normalized to the housekeeping gene β-actin (Actb). Primers are listed in Supplementary Table 1.

Total RNA from tissue samples was isolated by phenol chloroform using the TRIzol reagent (Invitrogen, Burlington, ON, Canada) as recommended by the manufacturer, and reverse transcription was performed with an Omniscript RT-PCR system (Qiagen, Mississauga, ON, Canada). The mRNA levels of selected genes were measured by real-time PCR with a Rotor-Gene 3000 real-time DNA detection system (Montreal Biotech, Kirkland, QC, Canada) and QuantiTect SYBR Green I PCR kits (Qiagen, Mississauga, ON, Canada) as previously described [33 (link)]. Expression levels were normalized to the housekeeping gene β-actin. The following primers were used: Hamp (F) CCTATCTCCATCAACAGATG; Hamp(R) AACAGATACCACACTGGGAA; β-actin (F) TGTTACCAACTGGGACGACA; β-actin (R) GGTGTTGAAGGTCTCAAA.