Total RNA from the strains was isolated and purified using hot phenol equilibrated with water [11 (link)]. The total RNA was precipitated with 3M sodium acetate/ethanol and centrifuged at 10,000 rpm for 15 min at 4 °C; the supernatant was discarded, and the total RNA was suspended in free-RNase water and stored at −70 °C. RNA samples were treated with the Ambion™ DNase I (RNase-free) kit (Thermo Scientific, Waltham, MA, USA), and integrity was analyzed in formaldehyde agarose gel. RNA concentrations were determined using a NanoDrop 2000 (Thermo Scientific). Four RNA extractions and purifications were carried out from four independent bioreactors. cDNA was synthesized using the RevertAid H Minus First Strand cDNA Synthesis Kit Revert AidTM (Thermo Scientific) using a mixture of specific DNA primers designed using the Primer Express 2.0 software (Perkin Elmer/Applied Biosystems, Waltham, MA, USA).
Ambion dnase 1 rnase free kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Ambion DNase I (RNase-free) kit is a laboratory product designed for the removal of DNA contamination from RNA samples. It provides a convenient and effective method for treating RNA samples with DNase I, an enzyme that specifically degrades DNA, without compromising the integrity of the RNA.
Automatically generated - may contain errors
Lab products found in correlation
Concert plant rna reagent, by Thermo Fisher Scientific (2 mentions)
Iproof high fidelity dna polymerase, by Bio-Rad (2 mentions)
Pk2wg7 plasmid, by Thermo Fisher Scientific (2 mentions)
Genejet gel extraction kit, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcriptase kit, by Thermo Fisher Scientific (2 mentions)
Ge nanovue spectrophotometer, by GE Healthcare (2 mentions)
Pjet1.2 blunt cloning vector, by Thermo Fisher Scientific (2 mentions)
T4 dna ligase, by New England Biolabs (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Primer express 2, by Thermo Fisher Scientific (1 mentions)
3 protocols using ambion dnase 1 rnase free kit
1
Total RNA Isolation and Purification Protocol
2
Isolation and Cloning of CaFT1 Gene from Coffee Leaves
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from coffee leaves was isolated using Concert™ Plant RNA Reagent (Invitrogen) following the manufacture's recommendation. RNA concentration and purity were measured by spectrophotometric analysis (GE NanoVue™ Spectrophotometer). All samples were treated with Ambion DNase I (RNase-free) kit (Thermo Fisher) and cDNA synthesized using High-Capacity cDNA Reverse Transcriptase Kit (Thermo Fisher) following the manufacturer's recommendation. Primers were designed for gene isolation with the putative CaFT1 sequence previously identified by in silico analysis and including the restriction sites SpeI in the forward primer and BsrGI in the reverse (5'Fw = ATGCCTAGAGGGGGAGGAGA; 5'Rv = TTATCGTCTTCTGCCTC). The Polymerase Chain Reaction (PCR) was carried out using iProof High-Fidelity DNA Polymerase (Bio-Rad) following the manufacture's protocol. PCR fragments were isolated from 1 % agarose gel after electrophoresis and purified by GeneJET Gel Extraction Kit (Thermo Fisher). The fragment generated was inserted into the PJET1.2/blunt cloning vector (Thermo Fisher) and transferred to pK2WG7 plasmid (Thermo Fisher), both previously digested using restriction enzymes, and then ligated with T4 DNA ligase (New England Biolabs -NEB). All procedures followed the manufacturer's instructions.
3
Isolation and Cloning of CaFT1 Gene from Coffee Leaves
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from coffee leaves was isolated using Concert™ Plant RNA Reagent (Invitrogen) following the manufacture's recommendation. RNA concentration and purity were measured by spectrophotometric analysis (GE NanoVue™ Spectrophotometer). All samples were treated with Ambion DNase I (RNase-free) kit (Thermo Fisher) and cDNA synthesized using High-Capacity cDNA Reverse Transcriptase Kit (Thermo Fisher) following the manufacturer's recommendation. Primers were designed for gene isolation with the putative CaFT1 sequence previously identified by in silico analysis and including the restriction sites SpeI in the forward primer and BsrGI in the reverse (5'Fw = ATGCCTAGAGGGGGAGGAGA; 5'Rv = TTATCGTCTTCTGCCTC). The Polymerase Chain Reaction (PCR) was carried out using iProof High-Fidelity DNA Polymerase (Bio-Rad) following the manufacture's protocol. PCR fragments were isolated from 1 % agarose gel after electrophoresis and purified by GeneJET Gel Extraction Kit (Thermo Fisher). The fragment generated was inserted into the PJET1.2/blunt cloning vector (Thermo Fisher) and transferred to pK2WG7 plasmid (Thermo Fisher), both previously digested using restriction enzymes, and then ligated with T4 DNA ligase (New England Biolabs -NEB). All procedures followed the manufacturer's instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!