Taqman 7900

Total RNA from cells was isolated using RNeasy Mini Kit (Qiagen, Germany). cDNA was then generated using First Strand cDNA Synthesis Kit (Fermentas, Germany) according to the manufacturer's instructions. Standard real-time PCR was carried out on TaqMan 7900 (Applied Biosystems by Life Technologies, Germany) using the DNA intercalating dye SYBR Green. Primer sequences can be found in Supplementary Tab. S5. Relative quantification method as described in [52 (link)] was applied and Delta C_t (ΔC_t) values were determined.

RNA was extracted using the Qiagen RNEasy Minikit as per the manufacturer’s instructions and reverse transcribed using the high-capacity cDNA synthesis kit (Applied Biosystems). Primers were designed using NCBI software (Table S2). Quantitative RT-PCR was performed on a Taqman 7900 instrument (Applied Biosystems) and using Fluidigm technology. Gene expression was determined relative to four housekeeping genes and expressed as 2^−ΔCt or compared with an untreated calibrator (2^−ΔΔCt) [24 (link)]. Multiplex PCR was performed as per [25 (link)].

Total RNA was extracted from cells using an RNeasy Mini Kit (Qiagen, Germany) and transcribed to cDNA using a First Strand cDNA Synthesis Kit (Thermo Fisher Scintific, USA) according to the manufacturer’s instructions. Standard quantitative real-time PCR was carried out on a TaqMan 7900 (Applied Biosystems, USA) using the DNA intercalating dye SYBR Green.

The real-time PCR specific for A. fumigatus amplified a 85 bps fragment of the mitochondrial cytochrome B. The pipeting TECAN EVO 150 robot (8 channels) was used to prepare a reaction mixture containing master mix ABI Taqman universal PCR, primer AFF (TTGTATTCTTCATGCCTAACGCA), primer AFR (CGGAACAATAGCAGGTGGAGTT), and the probe (FAM-AGGTGATAGTGAAAATTATGTTATGGCTAATCCAATGC-BHQ1). Each PCR reaction included 15 µl of reaction mixture and 5 µl of sputum DNA mixture. Real-time PCR was performed using Taqman 7900 (Applied Biosystems, Zug, Switzerland). After 2 minutes at 50°C and 10 minutes at 95°C, 45 cycles of 15 seconds at 95°C and 1 minute at 60°C were performed. The conversion of Cts in the target concentration was obtained using a calibration curve obtained by amplifying successive dilutions of a plasmid containing the A. fumigatus target sequence. The absence of inhibition was tested by a reaction containing the tested DNA and 1,000 copies of the plasmid containing the target. Each sample was analysed in duplicate. The limit of detection was one to ten copies of the target per reaction.

RNA extraction was performed using the Qiagen RNEasy Minikit according to the manufacturer’s instructions. Reverse transcription was performed using the high capacity cDNA synthesis kit (Applied Biosystems). Quantitative RT-PCR was performed using the Taqman system on a Taqman 7900 instrument (Applied Biosystems). Gene expression was determined relative to GAPDH and expressed either as 2^−ΔCt or compared to an untreated calibrator (2^−ΔΔCt)56 (link).