To characterize the biodistribution of algae motors, male CD-1 mice were fed an alfalfa-free diet (Labdiet, St. Louis, MO, USA) starting 1 week prior to the experiments. To compare the biodistribution between fluorescein-labeled algae motors (2 × 106) and Mg-based motors (0.5 mg), mice were administered the corresponding capsules containing the motors labeled with equal amounts of dye. To evaluate the influence of active propulsion and capsule protection, mice were administered with encapsulated active algae (1 × 106), encapsulated static algae (1 × 106), unencapsulated active algae (1 × 106), or PBS by oral gavage. The mice were euthanized at 5 h after administration. The entire GI tracts were then collected, rinsed with PBS, and imaged using a Xenogen IVIS 200 system. For quantitative fluorescent measurements, the collected tissues were weighed and then homogenized in PBS. The fluorescent signals were quantified using a Tecan Infinite M200 plate reader. To evaluate drug retention, male CD-1 mice were administered with algae-NP(Dox) motor capsules (5 μg of Dox), NP(Dox) capsules (5 μg of Dox), and PBS via oral gavage. At 3, 6, and 9 h after oral administration, the GI tracts were then collected, weighed, and then homogenized in PBS. The amount of Dox was quantified using a Tecan Infinite M200 plate reader based on absorbance readings at 480 nm.
Infinite m200 plate reader
Manufactured by Tecan
Sourced in Switzerland, Austria, United States, Germany, Japan, Italy
The Infinite M200 plate reader is a versatile instrument designed for absorbance, fluorescence, and luminescence measurements in microplates. It features an integrated injector system and advanced optical components to provide reliable and accurate data across a wide range of applications.
Automatically generated - may contain errors
Lab products found in correlation
Fetal calf serum (fcs), by Thermo Fisher Scientific (9 mentions)
1 step ultra tmb elisa, by Thermo Fisher Scientific (7 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (6 mentions)
Igepal, by Merck Group (5 mentions)
Indomethacin, by Merck Group (5 mentions)
Celltiter glo reagent, by Promega (5 mentions)
Ix71 microscope, by Olympus (5 mentions)
Cck 8, by Dojindo Laboratories (4 mentions)
Startingblock blocking buffer, by Thermo Fisher Scientific (4 mentions)
Insulin, by Merck Group (4 mentions)
Dexamethasone (dex), by Merck Group (4 mentions)
Nanoquant plate, by Tecan (4 mentions)
Passive lysis buffer (plb), by Promega (4 mentions)
Celltiter glo, by Promega (4 mentions)
Alamarblue reagent, by Thermo Fisher Scientific (4 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Alamarblue assay, by Thermo Fisher Scientific (3 mentions)
3 isobutyl 1 methyl xanthine (ibmx), by Merck Group (3 mentions)
Oil red o, by Merck Group (3 mentions)
Dual luciferase reporter assay system, by Promega (3 mentions)
418 protocols using infinite m200 plate reader
1
Characterizing Algae Motor Biodistribution
2
Cell Viability and Cytotoxicity Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were seeded with eight technical replicates on PLO-coated black 96-well plates with 15,000 cells per well. CellTiter-Blue® Cell Viability (CTB) Assay (Promega, WI, USA, G8081) was used to determine the metabolic activity of the cells. Two biological replicates were employed for this study. According to the manufacturer’s instructions, at the designated sample collection time points (Fig. 2 ), CellTiter-Blue® reagent was added to the cells and incubated for 2 h at 37 °C. The assay is based on the conversion of the redox dye resazurin into resorufin, a fluorescent end-product. The resulting fluorescence intensity (excitation: 560 nm, emission: 590 nm) was recorded with a Tecan infinite M200 plate reader and processed with the i-control 3.4.2.0 software (Tecan, Männedorf, Switzerland). The CytoTox 96® Non-Radioactive Cytotoxicity (LDH) Assay (Promega, WI, USA, G1782) was used to determine cell cytotoxicity. According to the manufacturer’s instructions, at the designated sample collection time points, CytoTox 96® working solution was added to wells and incubated for 30 min at room temperature. The assay is based on the quantification of extracellular LDH through the directly proportional formation of a dye. Absorbance was recorded at 490 nm with a Tecan infinite M200 plate reader and processed with the i-control 3.4.2.0 software (Tecan, Männedorf, Switzerland).
3
Diffusion, Lentiviral Transduction, and Hepatic Function Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Diffusion studies used FITC- and Rhodamine-labelled Dextran (4 and 70kDa, respectively, 1mg/ml) as previously described [19] . Labelled media was injected into a single engineered vessel lumen and fluorescence measured in 6 well plate format on an Infinite M200 plate reader (Tecan).
Lentiviral reporter constructs were generated as previously described [15 (link),20] (link). IgH-mRFP was cloned into pSIN-PURO by PCR and HepG2 cells infected at a multiplicity of infection (MOI) of 20 and selected with puromycin for 2 weeks. IgH-mRFP release was measured by fluorometry using an Infinite M200 plate reader (Tecan). Albumin in sampled media was quantified by enzyme-linked immunosorbent assay (ELISA) using a human albumin ELISA kit (Bethyl labs). Urea in sampled media was measured by acid- and heat-catalysed condensation of urea with diacetylmonoxime to give a coloured-product that was measured spectrophotometrically (Urea Nitrogen kit; StanBio Labs).
Lentiviral reporter constructs were generated as previously described [15 (link),20] (link). IgH-mRFP was cloned into pSIN-PURO by PCR and HepG2 cells infected at a multiplicity of infection (MOI) of 20 and selected with puromycin for 2 weeks. IgH-mRFP release was measured by fluorometry using an Infinite M200 plate reader (Tecan). Albumin in sampled media was quantified by enzyme-linked immunosorbent assay (ELISA) using a human albumin ELISA kit (Bethyl labs). Urea in sampled media was measured by acid- and heat-catalysed condensation of urea with diacetylmonoxime to give a coloured-product that was measured spectrophotometrically (Urea Nitrogen kit; StanBio Labs).
4
Quantitative Analysis of Tissue-Derived Biomolecules
5
Fluorescent AEA Uptake Assay in MDRSA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The uptake assay of fluorescent AEA (SKM 4-45-1; Cayman Chemical, Ann Arbor, MI, USA) [55 (link)] into MDRSA CI-M was performed by incubating 200 µL bacterial culture at an OD600nm of 0.3 in the absence (control) or presence of 5 µg/mL fluorescent AEA in PBS supplemented with 1% D-glucose, and the fluorescence intensity measured every 10 min for 2 h at 37 °C in the M200 Infinite plate reader with excitation at 488 nm and emission at 535 nm (Tecan M200 Infinite plate reader).
For spinning disk confocal microscopy, MDRSA CI-M at an OD600nm of 0.3 was incubated in the absence or presence of 5 µg/mL fluorescent AEA and/or 50 µg/mL AEA for 2 and 4 h in TSBG. At the end of incubation, the samples were fixed in 1% paraformaldehyde for 20 min, and then visualized using the Plan-Apochromat ×100 objective and the 488 nm excitation laser using the green filter for GFP.
For spinning disk confocal microscopy, MDRSA CI-M at an OD600nm of 0.3 was incubated in the absence or presence of 5 µg/mL fluorescent AEA and/or 50 µg/mL AEA for 2 and 4 h in TSBG. At the end of incubation, the samples were fixed in 1% paraformaldehyde for 20 min, and then visualized using the Plan-Apochromat ×100 objective and the 488 nm excitation laser using the green filter for GFP.
6
Assessing Pyoverdine Availability and Bacterial Growth
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess how our treatment regimes affect pyoverdine availability and bacterial growth, we performed in vitro growth assays. Overnight LB cultures (PAO1 and PAO1ΔpvdD) were washed twice and standardized for optical density (OD = 2) and then inoculated at 10−3 dilution to iron‐limited CAA supplemented with either gallium nitrate (Ga(NO3)3; 5, 10, 20, 50 and 250 μM) or purified pyoverdine (same concentrations), to respectively reduce or enhance the availability of pyoverdine. All conditions were carried out in fourfold replication. Growth was tracked over 24 hr (37°C) in 200 μl cultures in 96‐well plates (BD Falcon, Switzerland) using a Tecan Infinite M‐200 plate reader (Tecan Group Ltd, Switzerland). We measured OD at 600 nm and pyoverdine‐associated fluorescence (400 ex | 460 em), every 15 min following brief shaking of the plate (30s, 3.5 mm orbital displacement). As gallium increases pyoverdine fluorescence, we corrected fluorescence values using a previously published calibration curve (Ross‐Gillespie et al., 2014 ).
7
Methylation-dependent gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methylated pGL3-L1.3-Luc reporter plasmids were obtained by incubation with M.HpaII and controlled by digestion with HpaII and MspI. Cells were seeded in 6-well dishes at 7 × 105 cells/well. Three hours post seeding, cells were cotransfected with the unmethylated or methylated reporter plasmid pGL3-L1.3-Luc and effector constructs coding for Tet1CD/Tet1CDmut/ Mecp2/Tet1CD+Mecp2, respectively. Luciferase activity was determined using the “Luciferase Assay System” (Promega) as described by the manufacturer on a TECAN infinite M200 plate reader (Tecan Group Ltd.). To control for consistent transfection of methylated and unmethylated reporter plasmids, the fluorescent signal emanating from the effector proteins was quantified in parallel (GFP: excitation 475 nm, emission 520 nm; RFP: excitation 585 nm, emission 630 nm) and was used for normalization of the luciferase signal. In addition, fluorescent signals were used to control for homogeneous expression of Tet1CD in single (Tet1CD) and double (Tet1CD + Mecp2) transfected cells.
8
Isolation and Characterization of Total RNA from HEK Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from HEK cells using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. To remove traces of genomic DNA, RNA was treated with RNase-free, recombinant DNaseI (Macherey Nagel, Dueren, Germany) for 30 min at 37°C and further purified with the Qiagen RNeasy Mini Kit. To assess the concentration and purity of RNA, the ratio of absorbance at 260 nm and 280 nm was measured on a TECAN infinite M200 plate reader (Tecan Group Ltd., Maennedorf, Switzerland). To further verify RNA quality, total RNA was denatured for 5 minutes at 99°C, separated on a 1.5% Tris-acetate-EDTA/agarose gel supplemented with 0.05 µL/mL Roti-Safe GelStain (Carl Roth, Karlsruhe, Germany) by electrophoresis and imaged on an Amersham Imager 600 (GE Healthcare, Freiburg, Germany).
9
Quantifying Cell Migration Dynamics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following the migration assay of SaOS-2, SaOS-LM2, and HT-1080, transwell supports were washed twice with Dulbeco’s phosphate-buffered saline (Gibco, Cat.# 14190144) and cells that did not migrate were removed from the upper chamber using a moistened cotton swab. Migrated cells that adhered to the lower surface of the support were stained with crystal violet (Fisher Scientific, Cat.# C58125) for 10 min. Transwell supports were washed with Dulbeco’s phosphate-buffered saline three times and air-dried. Once dry, bright field images were taken using Olympus cellSens Dimension software (Version 2.1) on an Olympus SZX16-ILLT microscope (Olympus, Tokyo, Japan) with 5× objective lens and 2.9× zoom. The crystal violet bound to migrated cells was eluted from the supports by pipetting 400 µl of 33% acetic acid (Fisher Scientific, Cat.# A38500) into each upper chamber and shaking the plates for 10 min. Half of the eluent for each sample, 200 µl, was transferred to a 96-well clear microplate (Corning, Cat.# 3595) and the absorbance at 590 nm was determined using the Tecan Infinite M200 plate reader (Tecan Group Ltd., Männedorf, Switzerland) and Tecan i-control software (Version 3.91.0). Standard curves were generated for each cell line used in the migration assay and were used to calculate the cell concentration from the experimental absorbance measurements.
10
Quantifying 5hmC after Tet1 Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect 5hmC after Tet1 transfection, gDNA was extracted from HEK-EBNA cells as described previously.66 (link) Concentration and purity of DNA was measured on a TECAN infinite M200 plate reader (Tecan Group Ltd.) by the absorbance at 260 nm and 280 nm. 1 µg of gDNA was treated with or without 0.18 µM of T4 phage β-glucosyltransferase (T4-BGT)67 (link) in a final volume of 50 µl supplemented with 1x NEB cut smart buffer (NEB) and 1 mM of UDP-Glucose (Sigma-Aldrich) for 18 hours at 37°C. Then 0.5 µg of glucosylated or mock treated DNA was used for digestion with 100 units of MspI (NEB) at 37°C for 18 hours in a final volume of 20 µL, which was followed by treatment with 20 µg of proteinase K (PK, Carl Roth GmbH) for 30 min at 50°C. Following proteolysis, PK enzymatic activity was inactivated for 10 min at 98°C. The MspI-resistant fraction was amplified using qPCR with primers flanking the MspI site (F: 5'- ATCCCACACCTGGCTCAGAGGG -3′ and R: 5′- GTCAGGGGTCAGGGACCCACTT -3′). After qPCR, the relative amounts of 5hmC were analyzed as described previously.31 (link) To detect 5mC at position 482 in L1 5′UTR before Tet1 transfection, the gDNA was treated with or without T4-BGT as described above. Then, the gDNA was further treated with MspI, HpaII (50 units, NEB) or mock for 18 hours at 37°C. The qPCR and data analysis were performed as above.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!