Luc pair duo luciferase hs assay kit

Manufactured by GeneCopoeia

Sourced in United States, China

The Luc-Pair™ Duo-Luciferase HS Assay Kit is a laboratory tool designed for the measurement of luciferase reporter gene activity. It provides a sensitive and efficient method for quantifying both firefly and Renilla luciferase in a single sample.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 3000, by Thermo Fisher Scientific (8 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions) Pezx mt06 vector, by GeneCopoeia (4 mentions) Sanger dna sequencing, by Eurofins (3 mentions) Hmit022834 mt06, by GeneCopoeia (3 mentions) Primestar mutagenesis basal kit, by Takara Bio (3 mentions) Dual luciferase reporter assay system, by Promega (3 mentions) Sequencher 5, by Gene Codes (3 mentions) Plasmid midi kit, by Qiagen (3 mentions) Endofectin max transfection reagent, by GeneCopoeia (2 mentions) Cmit000001 mt06, by GeneCopoeia (2 mentions) Gene pulser 2, by Bio-Rad (2 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions) Fluostar optima reader, by BMG Labtech (2 mentions) Nanodrop 2000, by Thermo Fisher Scientific (2 mentions) Pmirglo dual luciferase reporter vector, by Promega (1 mentions) Dual luciferase reporter assay system, by Agilent Technologies (1 mentions) Transit x2, by Mirus Bio (1 mentions) Mir 484 mimic, by Thermo Fisher Scientific (1 mentions) Plenti utr luc psmg1, by Promega (1 mentions)

Spelling variants of this product

Luc-Pair Duo-Luciferase Assay (4 citations) Duo-Luciferase HS Assay Kit (4 citations)

52 protocols using luc pair duo luciferase hs assay kit

Dual Luciferase Reporter Assay for circRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

pmirGLO dual luciferase reporter vector (Promega, Beijing, China) was used for dual-luciferase reporter assay. The wild-type sequences of circMapk1, circDcbld2 and circTbcld20 were respectively cloned into the vector. Primers used for vector construction were listed in
Supplementary Table S3. And so were the mutated sequences of the above circRNAs with corresponding mutated miRNA binding sites. Wide-type circRNA vector/mutated vector and miRNA mimics/negative control were co-transfected into cells in 96-well plates using Lipofectamine 2000 according to the manufacturer’s instruction. Lysates were harvested and processed 36 h after transfection as the instructions of Luc-Pair Duo-Luciferase HS Assay Kit (GeneCopoeia, Rockville, USA). The luciferase activity was measured with a dual luciferase reporter assay system (Bio-Tek). For comparison, the FL (Firefly luciferase) activity was normalized with RL (
Renilla luciferase) activity.

Li H., Zhao Y., Shen Q, & Li H. (2022). Multiple circRNAs regulated by QKI5 conjointly spongemiR-214-3p to antagonize bisphenol A-inducedspermatocyte toxicity: Cooperative effects of circRNAs on spermatocyte toxicity. Acta Biochimica et Biophysica Sinica, 54(8), 1090-1099.

+ Open protocol

+ Expand

Dual-Luciferase Assay for miRNA-UTR Interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cloned 3′UTR sequence of LRRK2, SLC6A11, and CADM3 (mm10) and scrambles UTR were purchased from GeneCopoeia. UTR was cloned downstream to firefly luciferase of pEZX‐MT06 Dual‐Luciferase miTarget™ vector. The pEZX‐MT06‐scrambled UTR or pEZX‐MT06‐LRRK2, SLC6A11, and CADM3 3′UTR construct and miR‐181a‐5p, mir‐148a‐3p, and miR‐146a‐5p mimic or negative control were co‐transfected into HEK293‐T cells cultured in 96‐well plates using EndoFectin™ Max Transfection Reagents (Gene Copoeia) according to the manufacturer’s protocol. 48 hours after transfection, Firefly and Renilla luciferase activities were measured using a Luc‐Pair™ Duo‐Luciferase HS Assay Kit (for high sensitivity) (GeneCopoeia). Ratio of luminescence from the Firefly luciferase to the Renilla luciferase was calculated for each sample. The mean of luciferase activity of Firefly/Renilla was considered for the analysis. The relative luciferase activity was calculated by internal normalization for each sample. Relative luciferase activity was used to determine the micoRNA‐UTR binding.

Islam M.R., Kaurani L., Berulava T., Heilbronner U., Budde M., Centeno T.P., Elerdashvili V., Zafieriou M., Benito E., Sertel S.M., Goldberg M., Senner F., Kalman J.L., Burkhardt S., Oepen A.S., Sakib M.S., Kerimoglu C., Wirths O., Bickeböller H., Bartels C., Brosseron F., Buerger K., Cosma N., Fliessbach K., Heneka M.T., Janowitz D., Kilimann I., Kleinedam L., Laske C., Metzger C.D., Munk M.H., Perneczky R., Peters O., Priller J., Rauchmann B.S., Roy N., Schneider A., Spottke A., Spruth E.J., Teipel S., Tscheuschler M., Wagner M., Wiltfang J., Düzel E., Jessen F., Rizzoli S.O., Zimmermann W., Schulze T.G., Falkai P., Sananbenesi F, & Fischer A. (2021). A microRNA signature that correlates with cognition and is a target against cognitive decline. EMBO Molecular Medicine, 13(11), e13659.

+ Open protocol

+ Expand

Luciferase reporter assay for miRNA-gene interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols

293T cells were seeded into 24-well plates and transferred with pEZX-FR02-LDB2-3’UTR WT and pEZX-FR02-LDB2-3’UTR MUT (GenePharma Co., Ltd., China), along with miR-96-5p mimics or miR-NC following the instructions of Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). After transfection for 48h, luciferase activity was measured by Luc-Pair™ Duo-Luciferase HS Assay Kit (GeneCopoeia, Rockville, Md, USA). Every experiment was repeated more than 3-times.

Chu F., Xu X., Zhang Y., Cai H., Peng J., Li Y., Zhang H., Liu H, & Chen X. (2022). LIM-domain binding protein 2 was down-regulated by miRNA-96-5p inhibited the proliferation, invasion and metastasis of lung cancer H1299 cells. Clinics, 78, 100145.

+ Open protocol

+ Expand

miRNA Regulation of circRPMS1 Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols

The wild type sequence and mutants in binding sites of circRPMS1 was cloned downstream of FL reporter vector. The 50 miRNA mimics were obtained from GeneCopoeia (Shanghai, China). C666-1 cells (5×10³ cells/well) were seeded and cultured in 96-well plates for 24 hrs. The cells were co-transfected with FL reporter, Renilla luciferase reporter, and miRNA mimic for 48 hrs. Luciferase activity was measured using a Luc-Pair™ Duo-Luciferase HS Assay Kit (GeneCopoeia, Shanghai, China). Relative luciferase activity was normalized to Renilla activity.

Liu Q., Shuai M, & Xia Y. (2019). Knockdown of EBV-encoded circRNA circRPMS1 suppresses nasopharyngeal carcinoma cell proliferation and metastasis through sponging multiple miRNAs. Cancer Management and Research, 11, 8023-8031.

+ Open protocol

+ Expand

Luciferase Reporter Assay for miRNA Target Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

TCTTAAACATTGTTTTGTAGTGTATATTACTTGTCCATTCCTTTAAGGGGAGCTTTAAACACTCTTTTGTAGATTACTTTTGGGGGATATATTTTGAGAATGATGAAACGGAATAAAATTGTAAAAAATTAATTGTAGTTTTAA.
Seventy-thousand cells were seeded in 24-well plates and co-transfected with 100 nM of mirVana miRNA mimic, negative control #1 (Cat# 4464058), or miR-484 mimic (Cat# 4464066, Assay ID MC10379) from Thermo, 100 ng of luciferase reporter pLenti-UTR-Luc PSMG1 WT or pLenti-UTR-Luc PSMG1 MUT, and 4 ng of pRL-CMV Renilla luciferase reporter (Cat# E2261) from Promega (Madison, WI), using TransIT-X2 (Cat# 6004) from Mirus (Madison, WI). Cells were cultured for another 48 h and washed once in PBS. Using a Luc-Pair Duo-Luciferase HS Assay Kit (Cat# LF004) from GeneCopoeia (Rockville, MD), cells were then lysed, loaded onto white 96-wells in quadruplicates, and their luciferase/Renilla ratios were measured using a FLUOstar Omega microplate reader from BMG Labtech. The experiment was repeated for n = 4.

Lee D., Tang W., Dorsey T.H, & Ambs S. (2020). miR-484 is associated with disease recurrence and promotes migration in prostate cancer. Bioscience Reports, 40(5), BSR20191028.

+ Open protocol

+ Expand

Astrocyte Transfection and Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

For target validation, astrocytes were transfected with dual luciferase reporters (TIMP-2 and control clones, Cat # HmiT018093-MT06, and CmiT000001-MT06, respectively, GeneCopoeia™, Rockville, MD, USA) according to the manufacturer’s instructions. Following 48 h, cells were transfected with miRNA-301a-3p mimics (50 nM miRIDIAN, Dharmacon Inc., Lafayette, CO, USA) using the Dharmafect 4 transfection reagent. Luciferase assays were conducted 48 h after mimic treatment, using the Luc-Pair™ Duo-Luciferase HS Assay Kit (GeneCopoeia™), according to the manufacturer’s instructions. For functional evaluation of miR-301a-3p, astrocytes were treated with 50 nM miRNA-301a-3p mimics for 48 h, after which RNA was isolated for analysis.

Morad G., Daisy C.C., Otu H.H., Libermann T.A., Dillon S.T, & Moses M.A. (2020). Cdc42-Dependent Transfer of mir301 from Breast Cancer-Derived Extracellular Vesicles Regulates the Matrix Modulating Ability of Astrocytes at the Blood–Brain Barrier. International Journal of Molecular Sciences, 21(11), 3851.

+ Open protocol

+ Expand

Plin1 Luciferase Assay for OCA Treatment

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were transfected with Plin1 luciferase reporter constructs using Lipofectamine 2000 reagent according to the manual instruction and treated with OCA in the absence or presence of SP for 24 h. Cells were lysed and the luciferase activities were measured with the Luc-Pair Duo-Luciferase HS Assay Kit (GeneCopoeia, Rockville, MD, USA)^{65 (link)}.

Zhou J., Cui S., He Q., Guo Y., Pan X., Zhang P., Huang N., Ge C., Wang G., Gonzalez F.J., Wang H, & Hao H. (2020). SUMOylation inhibitors synergize with FXR agonists in combating liver fibrosis. Nature Communications, 11, 240.

+ Open protocol

+ Expand

Validation of circ-ACTR2 and HMGA2 Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

The prediction of the targets for circ-ACTR2 and miR-205-5p was carried out by starbase v2.0 (http://starbase.sysu.edu.cn). The wild-type (WT) and mutant-type (MUT) sequences of circ-ACTR2 were respectively used to construct the WT-circ-ACTR2 and MUT-circ-ACTR2 luciferase plasmids using the pEZX-FR03 plasmid (GeneCopoeia, Rockville, MA, USA). Also, the WT-HMGA2 3′UTR and MUT-HMGA2 3′UTR plasmids were generated. Plasmid transfection was performed in HRMCs together with miR-NC or miR-205-5p. After 48 h, the luciferase signal of each group was determined via the Luc-Pair™ Duo-Luciferase HS Assay Kit (GeneCopoeia).

Yun J., Ren J., Liu Y., Dai L., Song L., Ma X., Luo S, & Song Y. (2021). Circ-ACTR2 aggravates the high glucose-induced cell dysfunction of human renal mesangial cells through mediating the miR-205-5p/HMGA2 axis in diabetic nephropathy. Diabetology & Metabolic Syndrome, 13, 72.

+ Open protocol

+ Expand

Transfection and Luciferase Assay in C6 Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two promoter constructs were purchased from FulenGen (Guangzhou, China), namely pCRE-Luc and pPGC-1α-Luc, carrying cAMP response element (CRE) and peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) promoter sequences, respectively. Cultured C6 cells were seeded in 12-well plates at a density of 1 × 10⁵ per well and stayed overnight. Then the cells were transiently transfected with pCRE-Luc and pPGC-1α-Luc by lipofectamine 3000 reagent (Thermo Fisher Scientific), respectively [26 (link)]. After drug treatment, the cells were harvested and luciferase activity was measured using the Luc-Pair™Duo-Luciferase HS Assay kit (GeneCopoeia, Rockville, MD). Firefly luciferase activity was normalized to Renilla luciferase activity.

Yan L., Liu Z., Xu L., Qian Y., Song P, & Wei M. (2020). Identification of volatile active components in Acori Tatarinowii Rhizome essential oil from different regions in China by C6 glioma cells. BMC Complementary Medicine and Therapies, 20, 255.

+ Open protocol

+ Expand

Evaluating TOX Promoter Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human TOX promoter (from −2000 to +100 bp) was synthesized and subcloned into the pEZX‐FR01 vectors (GeneCopoeia). For TOX promoter activity, Jurkat cells were electronically transfected with reporter plasmids as well as plasmids overexpressing PRDM1. Dual‐luciferase reporter assays were performed 48h after transfection with the Luc‐Pair ™ Duo‐Luciferase HS Assay Kit (GeneCopoeia, LF004) according to the manufacturer’s instructions. Firefly luciferase activity was normalized to Renilla luciferase activity for each sample.

Chen J., Yang J., Li H., Yang Z., Zhang X., Li X., Wang J., Zhang Y., Chen S, & Song M. (2021). Single‐cell transcriptomics reveal the intratumoral landscape of infiltrated T‐cell subpopulations in oral squamous cell carcinoma. Molecular Oncology, 15(4), 866-886.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!