Miscript primer assay

Manufactured by Qiagen

Sourced in Germany, United States, United Kingdom, Canada, France

The MiScript Primer Assays are a range of pre-designed and validated primer sets for the detection and quantification of microRNA (miRNA) expression. These assays are designed to work with the miScript PCR System, allowing for accurate and reliable miRNA profiling.

Automatically generated - may contain errors

Lab products found in correlation

Miscript sybr green pcr kit, by Qiagen (180 mentions) Miscript 2 rt kit, by Qiagen (142 mentions) Mirneasy mini kit, by Qiagen (54 mentions) Trizol reagent, by Thermo Fisher Scientific (34 mentions) Miscript reverse transcription kit, by Qiagen (26 mentions) Trizol, by Thermo Fisher Scientific (19 mentions) Lightcycler 480, by Roche (18 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (13 mentions) Quantitect sybr green pcr master mix, by Qiagen (11 mentions) Miscript 2 reverse transcription kit, by Qiagen (11 mentions) Miscript universal primer, by Qiagen (10 mentions) Mirneasy kit, by Qiagen (10 mentions) Nanodrop 2000, by Thermo Fisher Scientific (10 mentions) Miscript rt kit, by Qiagen (8 mentions) 7900ht fast real time pcr system, by Thermo Fisher Scientific (7 mentions) Cfx96 real time pcr detection system, by Bio-Rad (6 mentions) Rneasy mini kit, by Qiagen (6 mentions) Quantitect primer assay, by Qiagen (6 mentions) Ssofast evagreen supermix, by Bio-Rad (6 mentions) Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (6 mentions)

Spelling variants of this product

MiScript primers (20 citations) MiScript primer assays kit (14 citations) MiScript miRNA Primer Assays (4 citations) Specific hsa-miR miScript Primer Assays (3 citations) MiScript miRNA PCR primer assays (3 citations) MiScript Assays (2 citations) MiScript Primer Assays specific for hsa-miR-34a-5p (2 citations) RNU5 miScript Primer Assays (2 citations) Custom miScript primer assays (2 citations) MiScript Primer Assays SYBR Green RT PCR kits (1 citations)

312 protocols using miscript primer assay

miRNA and mRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cell lines using a miRNeasy mini kit (Qiagen, Hilden, Germany). Relative miR expression analysis was performed by RT-qPCR into Roche LightCycler 480 II using miScript SYBR Green Assay Kit and miScript primer assays (Qiagen).
The miScript primer assay in combination with miScript SYBR Green PCR kit from Qiagen was used for detection of miR122, 144, 221 and 222. RT-qPCR analysis for ADAM10 and c-Met was performed as described [14 (link)]. Sequences of ADAM10 primers were: GAGGAGTGTACGTGTGCCAGTT, Forward, GACCACTGAAGTGCCTACTCCA, Reverse; c-Met primers were: TGCACAGTTGGTCCTGCCATGA, Forward, CAGCCATAGGACCGTATTTCGG, Reverse. Relative quantification of mRNAs was calculated by the Ct method. Standardization of miRs between samples was obtained by using U6 small nuclear RNA as an internal control. Sequences of internal control primers were: TGACTTTGTCACAGCCCAAG Forward, TTCAAACCTCCATGATGCTG Reverse, for B2M, TGCCCTGAGGCACTCTTC Forward, TGAAGGTAGTTTCGTGGATGC Reverse for ACTB, and GACAATGCAGAGAAGCTGG Forward, GCAGGAAGACATCATCATCC Reverse for RPII. Standardization of ADAM10 and c-Met genes was obtained by using -actin, 2-microglobulin and RNA polymerase II as internal control. Values are the mean ± sem of n = 3 independent RT-qPCR analyses.

Amaro A., Croce M., Ferrini S., Barisione G., Gualco M., Perri P., Pfeffer U., Jager M.J., Coupland S.E., Mosci C., Filaci G., Fabbi M., Queirolo P, & Gangemi R. (2020). Potential Onco-Suppressive Role of miR122 and miR144 in Uveal Melanoma through ADAM10 and C-Met Inhibition. Cancers, 12(6), 1468.

+ Open protocol

+ Expand

miRNA Expression Detection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the detection of miRNA expression, RNA was extracted from lungs, MLE12 cells, human tracheal aspirate (TA) pellets and primary T2AECs using miRNeasy mini kit (Qiagen, Valencia, CA). RNA concentration and quality was determined using a Biotek synergy II plate reader (Biotek, Winooski, VT). Across all samples the mean 260/280 ratio was greater than 2.0. cDNA was synthesized using a miScript II RT Kit (Qiagen, Valencia, CA). The StepOnePlus platform (Applied Biosystems) was used for all PCR, done in triplicate using miScript primer assay (Qiagen). Changes in expression were calculated by the change in threshold (ΔΔC_T) method with RNU6 as the endogenous control for miRNA analysis and ß-actin (ACTB) for primary miRNA for gene-expression analysis. The miScript primer assay (Qiagen) IDs are mouse MS00001428 (miR-34a), Human MS00003318 (miR-34a), MS00033740 (RNU6), Mouse MP00005614 (Pre-miR-34a) and Mouse QT01136772 (ACTB).

Syed M., Das P., Pawar A., Aghai Z.H., Kaskinen A., Zhuang Z.W., Ambalavanan N., Pryhuber G., Andersson S, & Bhandari V. (2017). Hyperoxia causes miR-34a-mediated injury via angiopoietin-1 in neonatal lungs. Nature Communications, 8, 1173.

+ Open protocol

+ Expand

Quantitative miRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Isolated miRNA was transcribed into cDNA using the miScript RT kit (Qiagen, Hilden, Germany). 5 μl miRNA sample were processed following the manufacturer’s protocol using the HiFlex Buffer. After reverse transcription the samples were diluted in 80μl RNase-free water. qPCR was performed using the miScript primer assays (miR-21, miR-31, miR-520e, miR-17, miR-106b) from Qiagen (Qiagen, Hilden, Germany). A master mix was prepared consisting of miScript Universal primer, miScript Primer assay, SyberGreen kit and RNase-free water (Qiagen, Hilden, Germany) following the manufacturer’s protocol. Samples were analyzed as triplicates in a 364 well plate with the Light Cycler 480 from Roche (Roche, Basel, Switzerland). As reference, miRNA-93 (Qiagen, Hilden, Germany) was used.

Kemski S., Molitor V., Steffens M., Nümm T.J., Herrmann N., Hornung T., Bieber T., Schumann C., Kächele V., Seufferlein T., Heinemann V., Scholl C, & Stingl J.C. (2021). Association between miRNA signatures in serum samples from epidermal growth factor inhibitor treated patients and skin toxicity. Oncotarget, 12(10), 982-995.

+ Open protocol

+ Expand

Quantifying miRNA-155 Expression via RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Per the manufacturer’s instruction, total RNA was reverse transcribed to generate complementary DNA (cDNA) using the miScript II RT Kit (Qiagen). Briefly, template RNA in tubes containing buffer, Nucleics Mix, Reverse Transcriptase Mix and RNase-free water was reverse transcribed at 37^oC for 60 min and 95^oC for five min to generate cDNA.
Quantitative PCR (qPCR) was performed using the StepOnePlus PCR System (Applied Biosystems, Foster City, CA), following preparation with miScript SYBR Green PCR Kit for Use with miScript Primer Assays (Qiagen). Primers for human and mouse miRNA-155 and the housekeeping gene RNU6 (miScript Primer Assay) were purchased from Qiagen. Cycling conditions were as follows: 40 cycles at 95^oC for 15 min, 94^oC for 15 s, 55^oC for 30 s, and 70^oC for 30 s. Data were analyzed using the delta-delta Ct method.

Johnson C., Drummer IV C., Shan H., Shao Y., Sun Y., Lu Y., Saaoud F., Xu K., Nanayakkara G., Fang P., Bagi Z., Jiang X., Choi E.T., Wang H, & Yang X. (2021). A Novel Subset of CD95+ Pro-Inflammatory Macrophages Overcome miR155 Deficiency and May Serve as a Switch From Metabolically Healthy Obesity to Metabolically Unhealthy Obesity. Frontiers in Immunology, 11, 619951.

+ Open protocol

+ Expand

Quantification of miR-155 in Sera

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total miRNA was isolated from patients’ sera by using the “miRNeasySerum/Plasma Kit” (Qiagen). MiR-155 was reversibly transcribed using miScript II RT Kit (Qiagen). In a reverse transcription reaction with miScript HiSpec Buffer, mature miRNAs are polyadenylated by poly(A) polymerase and converted into cDNA by reverse transcriptase with oligo-dT priming; and the cDNA was then used for real-time PCR quantification of mature miRNA expression. Relative miRNA expression levels for the candidate miR-155 were analyzed by miScript SYBR Green PCR Kit (Qiagen) and specific primers (Hs_miR-155_2 miScript Primer Assay [cat#: 218300], which target mature miR-155 (cat#: MS00031486; Qiagen) and Hs_SNORD68_11 miScript Primer Assay cat#: 218300) as housekeeper gene (HK), which targets SNORD68 small nucleolar RNA, C/D box 68 (cat#: MS000337). The amplification was done using 5 Plex Rotor Gene RealTime PCR Analyzer (Qiagen). The relative quantitation of miR-155 was calculated using the equation 2^−ΔΔCt test control.

Yehia R., Schaalan M., Abdallah D.M., Saad A.S., Sarhan N, & Saleh S. (2021). Impact of TNF-α Gene Polymorphisms on Pancreatic and Non-Small Cell Lung Cancer-Induced Cachexia in Adult Egyptian Patients: A Focus on Pathogenic Trajectories. Frontiers in Oncology, 11, 783231.

+ Open protocol

+ Expand

Intracellular Uptake Quantification of DUPA-miR-34a

Check if the same lab product or an alternative is used in the 5 most similar protocols

To evaluate the internalization of DUPA-miR-34a, 200,000 LNCaP or A549 cells per well were seeded in 12-well plates. The next day, cells were treated with 100 nM DUPA-NC or DUPA-miR-34a in 5% FBS containing RPMI media for 18 h. Cells transfected with 10 nM DUPA-miR-34a using lipofectamine RNAiMAX (Life Technologies) served as a positive control. After washing the cells with PBS, cells were incubated with 100 μg/mL RNase A for 5 min at 37°C to degrade any surface-bounded DUPA-miR-34a followed by extensive washing with PBS to remove any leftover RNase. Total RNA was isolated using the miRneasy Kit (217004, Qiagen) according to the manufacturer’s instruction. After DNase I digestion (79254, Qiagen) to remove genomic DNA, RNA integrity was evaluated by running 1.5% agarose gel and RNA concentration was quantified using NanoDrop 2000 spectrophotometer. We used 1 μg total RNA to make cDNA using an miScript Reverse Transcriptase kit (218161, Qiagen) using HiFlex buffer per manufacturer’s instructions. Real-time PCR was performed using miScript SYBR Green PCR Kit (Qiagen) with the following primers: MiR-34a-5p (MiScript primer assay; Qiagen) and RNU6B (non-target RNA, MiScript primer assay; Qiagen). Data were then analyzed using the 2^−ΔΔCt method and expressed as fold change.

Abdelaal A.M., Sohal I.S., Iyer S.G., Sudarshan K., Orellana E.A., Ozcan K.E., dos Santos A.P., Low P.S, & Kasinski A.L. (2024). Selective targeting of chemically modified miR-34a to prostate cancer using a small molecule ligand and an endosomal escape agent. Molecular Therapy. Nucleic Acids, 35(2), 102193.

+ Open protocol

+ Expand

Quantifying Mature and Precursor miRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA extracted from WT and CD47⁻ cells and their EVs and used to prepare cDNAs. Real-time PCR was performed according to manufactures instructions using miScript II RT Kit and real-time PCR was performed with miScript SYBR Green PCR Kit (Qiagen). Control primer was used for normalization miScript Precursor Assay and miScript Primer Assay (Qiagen). Mature miRNA and precursor miRNA were analyzed using miScript II RT Kit which contain miScript HiSpec Buffer and miScript HiFlex Buffer for cDNA synthesis along with mature and precursor miScript Primer Assays were purchased from Qiagen. The real-time PCR for miRNA expression of mature (miRNA-320a-3p) and precursor of miRNA-320a were analyzed according to manufactures instructions. Mature 22 nucleotide miRNAs were polyadenylated using poly(A) polymerase and reverse transcribed into cDNA using oligo-dT primers. The oligo-dT primers had a 3' degenerate anchor and a universal tag sequence on the 5' end, allowing amplification of mature miRNA in the real-time PCR step. miScript Primer Assay was used in combination with the miScript SYBR Green PCR Kit, to enable quantification of mature miRNA by real time PCR. The combination of polyadenylation and the universal tag addition ensured that miScript Primer Assays do not detect genomic DNA.

Kaur S., Saldana A.C., Elkahloun A.G., Petersen J.D., Arakelyan A., Singh S.P., Jenkins L.M., Kuo B., Reginauld B., Jordan D.G., Tran A.D., Wu W., Zimmerberg J., Margolis L, & Roberts D.D. (2021). CD47 interactions with exportin-1 limit the targeting of m7G-modified RNAs to extracellular vesicles. Journal of Cell Communication and Signaling, 16(3), 397-419.

+ Open protocol

+ Expand

qRT-PCR Quantification of miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression levels of microRNAs were measured by quantitative real-time polymerase chain reaction (qRT-PCR) using a Light Cycler® 96 Real-Time PCR System (Roche Diagnostics, Indianapolis, IN, USA). All PCR amplifications were performed in duplicate reactions and in final volume of 20 µL containing 2 µL cDNA, 10 µL 2x QuantiTect SYBR Green PCR Master Mix, 2 µL 10x miScript Primer Assay [miR-122 (MS00000315), or miR-34a (MS00000224); QIAGEN], 2 µL 10x miScript Universal Primer [(MS0003374); (QIAGEN)], and 4 µL RNAase free water using the following protocol: initial activation step at 95°C for 15 min to activate HotStar Taq DNA polymerase followed by 45 cycles at 94° for 15 s, 55°C for 30 s, and 70°C for 30 s. In addition, the no-template negative control (H₂O) was routinely run in every PCR. The levels of microRNAs expression were normalized with RNU6 (as an internal control) and the fold change was calculated using the 2^−ΔΔCt.

Akbari G., Mard S.A., Dianat M, & Mansouri E. (2017). The Hepatoprotective and MicroRNAs Downregulatory Effects of Crocin Following Hepatic Ischemia-Reperfusion Injury in Rats. Oxidative Medicine and Cellular Longevity, 2017, 1702967.

+ Open protocol

+ Expand

miR-205 and miR-338-5p Expression in Colon Cancer

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

miRNA were extracted from fresh frozen colon adenocarcinoma and normal colon tissues using miRNeasy mini kit (Qiagen) according to manufacturer’s instructions. RNA concentrations were measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific). cDNA was synthesized using miScript II RT Kit (Qiagen) in accordance with the manufacturer’s instructions.
Expression of miR-205 and miR-338-5p was determined by real time PCR using an Absolute SYBR Green Rox mix (Thermo Fisher Scientific), on a CFX 96 real time PCR detection system (Bio-Rad) and normalized using U6 small nuclear RNA. miR-205 is known to down-regulate LRP1 expression [42 (link), 43 (link)]. miR-338-5p is not implicated in LRP1 expression regulation and was used as control as previously described [43 (link)]. All primers were purchased as 10x miScript Primer Assay (Qiagen). PCR conditions were 15 min at 95° C, followed by 40 cycles each consisting of 15 s at 95° C (denaturation), 30 s at 55° C (annealing) and 30 s at 70° C (extension). The specificity of PCR amplification was checked using a heat dissociation curve from 65° C to 95° C following the final cycle. The cycle threshold (Ct) values were recorded with Bio-Rad CFX Manager^™ 3.0 software (Bio-Rad).

Boulagnon-Rombi C., Schneider C., Leandri C., Jeanne A., Grybek V., Bressenot A.M., Barbe C., Marquet B., Nasri S., Coquelet C., Fichel C., Bouland N., Bonnomet A., Kianmanesh R., Lebre A.S., Bouché O., Diebold M.D., Bellon G, & Dedieu S. (2018). LRP1 expression in colon cancer predicts clinical outcome. Oncotarget, 9(10), 8849-8869.

+ Open protocol

+ Expand

Identification of microRNA Binding Sites

Check if the same lab product or an alternative is used in the 5 most similar protocols

To find out the potential microRNA binding sites, 3'UTR region of a gene was scanned using TargetScan (www.targetscan.org/), miRBase (www.mirbase.org/), microRNA.org (www.microrna.org/), RegRNA (www.regrna.mbc.nctu.edu.tw/) and MicroCosm (www.ebi.ac.uk/enright-srv/microcosm/). Target microRNAs were selected based on its conserved seed match or seed match with a higher context score. Total RNA (1μg) isolated from tissue samples were reverse transcribed using miScript PCR starter kit (Qiagen) according to manufacturer’s protocol and microRNAs were quantified using miScript SYBR Green PCR kit and 10X miScript Primer Assay (specific for microRNA of interest, Qiagen). U6 small nuclear 2 was quantified to normalize the levels of microRNA expression using Hs_RNU6B_2 miScript Primer Assay (Qiagen).

Basu S., Majumder S., Bhowal A., Ghosh A., Naskar S., Nandy S., Mukherjee S., Sinha R.K., Basu K., Karmakar D., Banerjee S, & Sengupta S. (2015). A Study of Molecular Signals Deregulating Mismatch Repair Genes in Prostate Cancer Compared to Benign Prostatic Hyperplasia. PLoS ONE, 10(5), e0125560.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!