Lipofetamine rnaimax
Lipofectamine RNAiMAX is a cationic lipid-based transfection reagent designed for efficient delivery of small interfering RNA (siRNA) and other nucleic acids into a variety of mammalian cell lines. It facilitates the uptake of siRNA into cells, enabling effective gene silencing.
Lab products found in correlation
7 protocols using lipofetamine rnaimax
Lipofectamine-mediated Transfection and Silencing in Adipocytes
siRNA Transfection Protocols for DNA Repair Genes
siRAD51 5′ GACUGCCAGGAUAAAGCUU was used in a previous study61 (link).
siDNA2 5′ CAGUAUCUCCUCUAGCUAG was used in a previous study6 (link).
siFANCD2 5′ CAGAGUUUGCUUCACUCUCUA was used in a previous study62 (link)siMUS81 5′ CAGCCCUGGUGGAUCGAUA was used in a previous study63 (link).
siFBH1 5′ GGAUGUUUGCAAGAGAGUCAGGAAA.
siRNA Knockdown of ERH in HCC Cells
Evaluation of Apoptosis and Stemness
Knockdown of SRSF1 and SEDT2 in Human Cells
3T3-L1 Adipocyte Electroporation and Silencing
For colocalization analysis of NECC2 and cavin1, cells were transfected with Lipofectamine 2000 (Invitrogene, Barcelona, Spain) and the expression vector coding for GFP‐Necc2, cultured for 48 hours and then immunostained for cavin1. For Cav1 silencing studies, 3T3‐L1 adipocytes were transfected with Lipofetamine RNAiMAX (Invitrogen) and Cav1 siRNA (Dharmacon, Lafayette, CO, USA) and cultured for 72 hours before NECC2 immunostaining.
Plasmid Cloning and Transfection Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!