The largest database of trusted experimental protocols

7 protocols using lipofetamine rnaimax

1

Lipofectamine-mediated Transfection and Silencing in Adipocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
For expression assays, 3T3‐L1 cells, human adipocytes, and HEK-293 AD cells, were transfected with the corresponding plasmid vectors at 2.5 µg/mL using a 7.5:1000 dilution of Lipofectamine 2000 (Invitrogen), and cultured for 48 h prior to the experiments. For silencing studies, cells were transfected with a 7.5:1000 dilution of Lipofetamine RNAiMAX (Invitrogen) and mouse Rab34 siRNA (Dharmacon), mouse UBA1 siRNA (Dharmacon), or control siRNA (Sigma-Aldrich) (scrambled-transfected cells) at 25 nmol/L. Then, cells were kept in culture for 72 h. At the end of the experiments, cells were processed for confocal microscopy and/or immunoblotting as indicated in the corresponding sections. In another set of experiments, cells were collected in radioimmunoprecipitation assay (RIPA) buffer and intracellular concentration of TGs was determined using Triglyceride Reagent (Sigma-Aldrich) and Amplex UltraRed Reagent (Invitrogen), while culture media were analyzed for free glycerol content using Amplex UltraRed Reagent (Invitrogen) and Free Glycerol Reagent (Sigma-Aldrich) as previously described [24 (link)].
+ Open protocol
+ Expand
2

siRNA Transfection Protocols for DNA Repair Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNAs were transfected using Lipofetamine RNAiMAX as per manufacturer’s instructions (Invitrogen). The All-Star negative control (siNS) siRNA was used as a control (Qiagen). The following siRNA sequences were used in this study.
siRAD51 5′ GACUGCCAGGAUAAAGCUU was used in a previous study61 (link).
siDNA2 5′ CAGUAUCUCCUCUAGCUAG was used in a previous study6 (link).
siFANCD2 5′ CAGAGUUUGCUUCACUCUCUA was used in a previous study62 (link)siMUS81 5′ CAGCCCUGGUGGAUCGAUA was used in a previous study63 (link).
siFBH1 5′ GGAUGUUUGCAAGAGAGUCAGGAAA.
+ Open protocol
+ Expand
3

siRNA Knockdown of ERH in HCC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
siERH-3 and siERH-5 were obtained from Dharmacon (Lafayette, CO) and Qiagen (Venlo, Netherlands), respectively. Control siRNA was from Qiagen. Sequence for the siRNAs were as followed: siERH #3 GAACTTATGCTGACTACGA and siERH #5 GAGGATCTTGTTCAATCGGAA. Transfection of siRNA into HCC cells was performed using Lipofetamine RNAiMAX (Invitrogen, Carlsbad, CA) following manufacturer's instruction at final concentration of 10 nM.
+ Open protocol
+ Expand
4

Evaluation of Apoptosis and Stemness

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hoechst 33342, verapamil, glutaminase, L-asparaginase, and 3-Amino-1,2,4-triazole (ATZ), 3-(4,5 dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), hydroethidine, Rhodamine 123 were purchased from Sigma (St Louis, MO, USA). Rabbit monoclonal anti-Axin2 (D48G4), rabbit monoclonal anti-Survivin (71G4B7), rabbit polyclonal anti-phospho-β-catenin (Ser33/37/Thr41), rabbit monoclonal anti-phospho-Akt (Ser473) antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA). Mouse monoclonal anti-c-Myc (9E10) was purchased from Santa Cruz (Santa Cruz, CA, USA). Rabbit polyclonal anti-CyclinD1 antibody was obtained from GeneTex (San Antonio, TX, USA). Mouse monoclonal anti-β-catenin (C47H1), rabbit monoclonal anti-Sox-2, rabbit monoclonal anti-ABCG2, and mouse monoclonal anti-β-actin antibodies were purchased from Abcam (Cambridge, UK). CM-DCFDA, Lipofetamine RNAiMAX and Opti-MEM were purchased from Invitrogen Life Technologies (Carlsbad, CA, USA).
+ Open protocol
+ Expand
5

Knockdown of SRSF1 and SEDT2 in Human Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A human fibroblast cell line (established from normal human skin, 27 years old, male, Asian) was kindly provided by Dr. Chung-Hsing Chang (School of Medicine, College of Medicine, China Medical University, Taichung, Taiwan), and the A549, GBM8401, and Huh-7 cell lines were obtained from the Bioresource Collection and Research Center. Cells were maintained in Dulbecco’s Modifed Eagle’s medium that was supplemented with 10% fetal bovine serum and antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin) at 37 °C in a humidified atmosphere of 5% CO2. To perform SRSF1 or SEDT2 knockdown, antisense oligonucleotide sequences of SRSF1, SEDT2, or a scrambled control (Supplementary Table S1) were transfected into cells using Lipofetamine RNAiMAX (Invitrogen) according to the manufacturer’s protocol.
+ Open protocol
+ Expand
6

3T3-L1 Adipocyte Electroporation and Silencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
3T3‐L1 adipocytes were electroporated (Gene PulserXcell, Bio‐Rad) as previously described.19 For overexpression analysis, cells were electroporated with a phrGFP‐N1 expression vector (mock‐transfected cells) or a GFP‐Necc2 construct 18 and cultured for 48 hours prior to the experiments. For silencing studies, a specific shRNA for Necc2 silencing (5′‐GGAGGAGATAAGATTTAAA‐3′) was cloned using the BgIII and HindIII sites in front of the H1‐RNA promoter of the pEGFP‐RNAi plasmid as described earlier.18 Cells expressing pEGFP‐shRNA (control shRNA) or pEGFP‐Necc2‐shRNA plasmid (NECC2 shRNA) were kept in culture for 72 hours before performing the experiments.
For colocalization analysis of NECC2 and cavin1, cells were transfected with Lipofectamine 2000 (Invitrogene, Barcelona, Spain) and the expression vector coding for GFP‐Necc2, cultured for 48 hours and then immunostained for cavin1. For Cav1 silencing studies, 3T3‐L1 adipocytes were transfected with Lipofetamine RNAiMAX (Invitrogen) and Cav1 siRNA (Dharmacon, Lafayette, CO, USA) and cultured for 72 hours before NECC2 immunostaining.
+ Open protocol
+ Expand
7

Plasmid Cloning and Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmid EF.hHES1.Ubc.GFP and plasmid EF.deltaBHES1.Ubc.GFP were acquired from Linzhao Cheng’s lab [24 (link)] via addgene Inc. (Cambridge, MA). The Flag-Hes1 was generated by digesting EF.hHES1.Ubc.GFP with BamHI and XhoI, and inserting the digested plasmid into the multiple cloning sites of the pcDNA4-TAG vector (Invitrogen, Carlsbad, CA). Stattic was obtained from Sigma-Aldrich (St. Louis, MO). Control siRNA and Hes1 siRNA were obtained from Qiagen (Venlo, Netherlands). Lipofetamine RNAiMAX (Invitrogen) was used as an siRNA transfection reagent. The protocol was done according to the manufacturer’s instructions at a final concentration of 10nM.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!