Taqman fast advanced master mix

Total miRNAs were extracted using the miRVana microRNA isolation kit (AM1561, mirVana™ miRNA Isolation Kit; Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. miRNAs reverse transcription was carried out using TaqMan Advanced miRNA cDNA Synthesis Kit (A28007, Thermo Fisher Scientific, Waltham, MA, USA). Taqman probes specific for the analyzed miRNAs (Supplemental Table S1) were used (TaqMan Advanced miRNA Assay, Thermo Fisher Scientific, Waltham, MA, USA). Briefly, 2 µg of total miRNA/sample were used. Polyadenylation reaction conditions were incubation for 45 min at 37 °C, 10 min at 65 °C; followed for the adapter ligation reaction: 60 min at 16 °C and retro-transcription at 42 °C for 15 min, incubation at 85 °C for 5 min. Amplification reaction (miR-Amp) was carried out for 15 cycles using 95 °C/3 s for denaturalization and 60 °C/30 s in the annealing. qRT-PCR using Taqman Fast Advanced Master Mix (cat. 4444557) was performed as follows: enzyme activation (95 °C for 20 s) followed by 60 cycles of denaturalization (95 °C/1 s) and annealing (60 °C/20 s) in a Lightcycler 96 equipment (Roche, Rotkreuz, Switzerland). mmu-miR-16-5p was used for normalization of samples using 2ΔCt analysis [27 (link)].

RNA was isolated by column separation using the RNeasy Kit (Qiagen) following manufacturer’s instructions and the concentration was measured with Nanodrop 2000 (Thermo Fisher Scientific). A quantity of RNA in the range 200 – 500 ng was used for cDNA synthesis using the PrimeScript RT-PCR Kit (Takara-Bio). Quantitative PCR was then performed using Taqman Fast Advanced MasterMix with Universal Probe Library Probes (Roche) with specific primers designed using the Roche Lifescience Assay Design Center (https://lifescience.roche.com/en_it/brands/universal-probe-library.html#assay-design-center) on a StepOnePlus Real-Time PCR System (Thermo Fischer Scientific). A relative quantification method was used, with GAPDH or Beta-Actin as housekeeping genes. Primers used in this study: IFN-β Fw-CTTTGCTATTTTCAGACAAGATTCA, Rev-GCCAGGAGGTTCTCAACAAT; ISG15 Fw-GCGAACTCATCTTTGCCAGTA, Rev-CCAGCATCTTCACCGTCAG; ISG56 Fw-GCCTAATTTACAGCAACCATG, Rev-TCA TCAATGGATAACTCCCATGT; CXCL10 Fw-GAAAGCAGTTAGCAAGGAAAG, Rev-GACATATACTCCATGTAGGGAAGTGA; IL-6 Fw-GATGAGTACAAAAGTCCTGATCCA, Rev-CTGCAGCCACTGGTTCTGT; TNF-α Fw-GACAAGCCTGTAGCCCATGT, Rev-TCTCAGCTCCACGCCATT; DENV NS4A Fw-ATCCTCCTATGGTACGCACAAA, Rev-CTCCAGTATTATTGAAGCTGCTATCC; hCoV-229E Fw-ACCAACATTGGCATAAACAG, Rev-CGTTGACTTCAAACCTCAGA; β-Actin Fw-ATTGGCAATGAGCGGTTC, Rev-TGAAGGTAGTTTCGTGGATGC; GAPDH Fw-AGCCACATCGCTCAGACA, Rev-GCCCAATACGACCAAATCC.

Total RNA was isolated from quadriceps muscles from 3-week-old WT, miR-21 ko, dy^3K/dy^3K and dy^3K/miR-21 mice and from 6-week-old WT, miR-21 ko, dy^2J/dy^2J and dy^2J/miR-21 mice using miRNeasy Mini Kit (Qiagen, Valencia, CA), including DNA digestion by DNase I following the manufacturer’s specifications. Concentration and purity of RNA samples were assessed using NanoDrop 1000 Spectrophotometer (ThermoFisher Scientific, Waltham, MA). For miRNA expression analysis, 10 ng of muscle RNA was reverse transcribed to cDNA using the TaqMan Advanced miRNA cDNA Synthesis Kit (Applied Biosystems, Waltham, MA). For mRNA expression analysis, 50 ng RNA was reverse transcribed to cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA) according to manufacturer’s protocol. The amplification was performed in a LightCycler 480 Real-Time PCR System (Roche Diagnostics, Basel Switzerland) using TaqMan Fast Advanced Master Mix. TaqMan probes detecting mouse miR-21, miR-93 (reference miRNA), TGF-β and Rn18s (reference gene) were used (Applied Biosystems, Waltham, MA). Comparative CT method was used for relative quantitation.