Taqman mirna reverse transcription kit

Total RNA was separated from tissues and cells with the usage of TRIzol reagent (Invitrogen). RNA quality was examined by A260/A280 absorption. Briefly, cDNA was synthesized by using a TaqMan miRNA reverse transcription kit (Takara). The quantitative real-time PCR (RT-qPCR) was carried out with a SYBR Premix Ex Taq kit (TaKaRa) on an ABI 7500 RT-PCR system (Applied Biosystems, USA). Relative quantification was achieved by normalization to the amount of GAPDH mRNA or U6, and the relative expression levels of genes were calculated using 2^–ΔΔCT method.

Total RNA was extracted using Trizol reagent (Takara, Japan). PrimeScriptTM RT Master Mix purchased from Takara and the Taqman miRNA reverse transcription Kit (Carlsbad, USA) were used for reverse-transcription. SYBR Select Master Mix was used for qPCR. The relative expression of LINC00641 and miR-582-5p were normalized to GAPDH and U6. The primers are as follows:
LINC00641:
Forward 5′-CAGCCTATGACAGACAGCCC-3′
Reverse 5′-CCAGTTGGTGCTGCCATTTG-3`
miR582-5p:
Forward 5′-ATCCCTAGCTTCAACGTG-3′
Reverse 5′-CGTTACAATTGCTAGC-3′
U6:
Forward 5′-CTCGCTTCGGCAGCACA-3′
Reverse5′-AACGCTTCACGAATTTGCGT-3′
GAPDH:
Forward 5′-ACAACTTTGGTATCGTGGAAGG-3′
Reverse 5′-GCCATCACGCCACAGTTTC-3′

Total RNA from livers and cells was isolated using the TRIzol reagent (TaKaRa, China) according to the manufacturer’s protocols, and reverse transcribed using a TaqMan miRNA Reverse Transcription Kit. The RNA was quantified using an Applied Biosystems 7300 System (Applied Biosystems, United States) using Quantitative RT-PCR (qPCR) with TaqMan miRNA assay Kit (GenePharma Corp, China). The quantity and purity of total RNA samples were tested by UV spectroscopy (Thermo Fisher Scientific, United States). The miRNA expression level was normalized to endogenous expression of RNA U6.

Plasma miR-497 was isolated by using miRNeasy Mini Kit (Qiagen, Valencia, CA). Reverse transcription was performed using the TaqMan miRNA reverse transcription kit (Takara, Japan). qRT-PCR was performed on ABI 7500 with SYBR Premix Ex Taq Kit (Takara, Japan). In short, the reactions were started at 95°C for 30s, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. Internal control was the U6 small nuclear RNA. Ct value of samples was recorded. Data were normalized by using 2^−ΔΔCt method [25 (link)].

Total RNA was extracted using TRIzol (Invitrogen) and reverse transcription was performed with PrimeScript RT reagent kit (Takara, Otsu, Japan) or TaqMan miRNA Reverse Transcription Kit (Takara) according to the manufacturer’s instructions. Quantitative RT-PCR was conducted using Power SYBR Green (TaKaRa) on StepOnePlus system (Applied Biosystems) with the following primer sequences: PRKAG2-AS1 forward: 5ʹ‐CCCAACTAGACACCTACATCC‐3ʹ and reverse: 5ʹ‐GCTTGATCTCTACCCTTGCTT‐3ʹ; SRRM2-AS1 forward: 5ʹ-TCCTGCTATCGCTTCCCAGT‐3ʹ and reverse: 5ʹ-GGTTGCGACGTAATAGGAAGGT‐3ʹ; STRADA, forward: 5′‐CGGGTGACACTCGGAGAAAA‐3′, reverse: 5′‐AGTGAGCAGCTCGTAACACC‐3; GAPDH forward: 5ʹ-GGAGCGAGATCCCTCCAAAAT‐3ʹ and reverse: 5ʹ‐GGCTGTTGTCATACTTCTCATGG‐3ʹ; miR‐6514, forward: 5′‐TATGGAGTGGACTTTCAGCTGGC‐3′, reverse: 5′‐CTGGAGTGGAAGAACAGGCA‐3′; miR‐1275, forward: 5′‐TGGGGGAGAGGCTGTC‐3′, reverse: 5′‐GAACATGTCTGCGTATCTC‐3′; U6, forward: 5′‐CTCGCTTCGGCAGCACAT‐3′, reverse: 5′‐TTTGCGTGTCATCCTTGCG‐3′; The relative expression level was calculated with 2^−ΔΔCt method with GAPDH or U6 as the internal reference for normalization.