Real time pcr detection system

Total RNA was extracted from the skin tissues using TRIzol reagent (Invitrogen, Karlsruhe, Germany) according to the manufacturer’s protocol. The total RNA (1 μg) was reverse transcribed at 37°C using PrimeScript^™ RT Enzyme (Takara, Shiga, Japan). Real-time RT-PCR was performed using a real-time PCR detection system (Takara Bio, Madison, WI, USA), and expression of the following genes was detected in the AA (-), AA (+), and AJ groups: tyrosinase (Tyr), tyrosinase related protein-1 (Tyrp1), dopachrome tautomerase (Dct), Tnf-α, endothelin 1 (Edn1), and cyclin D1 (Ccnd1). The final mixture for RT-PCR consisted of 1× SYBR Premix Ex Taq Mix (Takara), 0.4 μM of primers (forward and reverse), and cDNA. The primer sequences are provided in Table 1. The PCR amplification consisted of 40 cycles (95°C for 5 s and 60°C for 30 s) after an initial denaturation step (95°C for 10 s). The mRNA expression levels were evaluated relative to the level of ribosomal protein, large, P1 (Rplp1), and the mRNA levels of the AA (+) group were designated as 1.0.

Quantitative reverse transcription (qRT)-polymerase chain reaction (PCR) was performed for samples collected from all animals in both groups (control, n = 8; RA, n = 9). Briefly, purified total RNA (0.5 μg) was reverse transcribed using the PrimeScript RT Reagent kit (TaKaRa, Shiga, Japan) and the synthesized cDNA was amplified on a Rotor-Gene 6000 instrument (Corbett Research, Sydney, Australia) using TB Green Premix EX Taq II (TaKaRa). Primers (Supplementary Table S1) were designed using the PRIMER3 web application. SYBR green EX (TaKaRa) was used on a real-time PCR detection system (TaKaRa). Relative mRNA amounts were normalized to glyceraldehyde-3-phosphate dehydrogenase (Gapdh) mRNA and expressed as fold changes.

Total RNA was extracted from cells using TRIzol (Life Technologies, CA, USA). Two micrograms of total RNA from each test was reverse‐transcribed using M‐MLV‐RTase (Promega, Madison, WI, USA), according to the manufacturer's guidelines. qreverse transcriptase‐polymerase chain reaction (qRT‐PCR) was performed in a Bio‐Rad Real‐Time PCR detection system utilizing the SYBR premix ex taq (Takara Bio, Dalian, China). The primers used were as follows: CENPK forward, 5'‐AGTACCTTGGGCGAGTTTCTA‐3’ and reverse, 5'‐AGGCAATTCCATTACGCAGCA‐3’; PTEN forward, 5'‐TTTGAAGACCATAACCCACCAC‐3’ and reverse, 5'‐ATTACACCAGTTCGTCCCTTTC‐3’; and GAPDH forward, 5'‐GGAAGCTTGTCATCAATGGAAATC‐3’ and reverse, 5'‐TGATGACCCTTTTGGCTCCC‐3'. Relative expression levels were calculated using the 2^−ΔΔCt method.

Real-time PCR was performed using Takara SYBR^® Premix Ex Taq II (Tli RNaseH Plus) (2×) on a CFX96 Real-Time PCR Detection System. The reaction volume was 25 μL, containing 12.5 μL of Takara SYBR^® Premix Ex Taq II (Tli RNaseH Plus) (2×), 1 μL of each primer and 2 μL of the cDNA template. Amplification conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 64°C (55°C for GAPDH) for 30 s. SYBR^® Green PCR mix and primers that were specific to our target gene were used to efficiently amplify the target region. The primers used were as follows: GAPDH sense: 5′-GCACCACCAACTGCTTAGCAC-3′; GAPDH antisense: 5′-TCTTCTGGGTGGCAGTGATG-3′; FOLR2 sense: 5′-ACTTCTGCTGCTTCTGGTCT-3′; FOLR2 antisense: 5′-GTCATGCAGCTTGTCCTCAG-3′.