The pGL4.31 (luc2P/GAL4UAS/Hygro) and pBIND vectors were obtained from Promega (Madison, WI, USA). An IRES-GFP sequence was first cloned into the pBIND vector. Human RORγt was then amplified using cDNA isolated from human peripheral blood mononuclear cells (PBMCs) (provided by Dr. Hui Zhang) and inserted into the reconstructed pBIND-IRES-GFP vector to generate a Gal4–RORγt-LBD-IRES-GFP fusion sequence. The primers that used to construct the pBIND- Gal4–RORγt-LBD-IRES-GFP plasmid are as follows: RORγt-LBD forward 5′- AACTAGGATCCGAAACCGATGCCAGCACTGC-3′,reverse5′- AACTAGGATCCGCCTGCTGACAGAAAGCCA -3′.
Pbind vector
Manufactured by Promega
Sourced in United States
The PBIND vector is a plasmid designed for protein expression in bacterial systems. It provides a binding domain that can be used to immobilize or purify the expressed protein. The core function of the PBIND vector is to facilitate the production and isolation of recombinant proteins.
Automatically generated - may contain errors
Lab products found in correlation
Pact vector, by Promega (4 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Dual luciferase reporter assay system, by Promega (2 mentions)
Fast mutagenesis system, by Transgene (2 mentions)
Pires2 egfp, by BD (1 mentions)
Pcmv myc, by BD (1 mentions)
Pcmv ha, by BD (1 mentions)
Checkmate mammalian two hybrid system, by Promega (1 mentions)
Pgl4.17 reporter vector, by Promega (1 mentions)
Lipofectamine rnaimax transfection kit, by Thermo Fisher Scientific (1 mentions)
Lipo2000, by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter system, by Promega (1 mentions)
Prl tk renilla luciferase vector, by Promega (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Huh 7 cell line, by Health Science Research Resources Bank (1 mentions)
Pci neo, by Promega (1 mentions)
Qiafilter plasmid maxi kit, by Qiagen (1 mentions)
Pcmv ha n vector, by Takara Bio (1 mentions)
Pgl3 basic vector, by Promega (1 mentions)
Pg5luc vector, by Promega (1 mentions)
19 protocols using pbind vector
1
Construction of Gal4-RORγt Fusion Plasmid
2
Plasmid Construction for Transcription Factor Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression plasmid pcDNA3.1-Mef2c and 3× MEF2-luciferase reporter construct, which contain three upstream tandem repeats of a MEF2 binding site sequence from the desmin gene, were kindly provided by Eric N. Olson.
The Suv39h1 gene was amplified using SF1-SF3 primers (Table 1 ). Then, the recombinant plasmids were separately digested with Xho I and EcoR I or Sal I and Not I, and ligated into the pIRES2-EGFP (BD Biosciences Clontech, Franklin Lakes, NJ, USA), pCMV-Myc (BD Biosciences Clontech), and pBIND vectors (Promega, Madison, WI, USA), separately.
The Mef2c gene was amplified using MF1 primers (Table 1 ) designed according to the Sus scrofa Mef2c gene (accession number: NM001044540). Then, the recombinant plasmids were digested with Sal I and Not I, and ligated into the pCMV-HA (BD Biosciences Clontech), and pACT vectors (Promega), separately.
The HP1α gene was amplified using HF1-HF3 primers (Table 1 ). Then, the recombinant plasmids were digested with Nhe I and Xho I, and EcoR I and Xho I, or Sal I and Not I, and ligated into the pIRES2-EGFP, pCMV-HA, and pBIND vectors, respectively.
The Suv39h1 gene was amplified using SF1-SF3 primers (
The Mef2c gene was amplified using MF1 primers (
The HP1α gene was amplified using HF1-HF3 primers (
3
Mammalian Two-Hybrid Assay for DUX4/IGH and RAG1/RAG2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
This assay was performed using the CheckMateTM Mammalian Two‐Hybrid system (Promega, Madison, WI, USA) in 293T cells. To detect the interaction between DUX4/IGH and RAG1/RAG2, the cDNA of WT/mutant DUX4/IGHs and paired box 5 (PAX5) were engineered into pACT vectors (Promega), in which the latter was used as a positive control. The cDNA of RAG1 and RAG2 were cloned into pBIND vectors (Promega). The 293T cells were co‐transfected with pG5‐luc, pBIND‐RAG1/2, and WT/mutants pACT‐DUX4/IGH mixtures at a molar ratio of 1:1:1 using Lipofectamine 2000 (Invitrogen). The transfected 293T cells were harvested after 48 h. The relative luciferase activities were determined by using the Dual‐Luciferase Reporter Assay System (Promega). In brief, the harvested cells were lysed with the lysis buffer in the above kit for 15 min, then centrifuged for 5 min at 12,000 rpm to collect the supernatant and discarded the cell debris. The biofluorescence of different samples was measured by using a luminometer (Titertek‐Berthold, Huntsville, AL, USA). The relative reaction values of all samples were normalized against the empty vector.
4
LXRβ-LBD Structural Mutants Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild-type gene of human LXRβ-LBD was obtained by PCR from HepG2 cells and cloned into the pBIND vector (Promega, Madison, WI, USA), which included the GAL4 DNA-binding domain (GAL4-DBD) in order to construct the pBIND-LXRβ-LBD plasmid. The LXRβ-LBD forward primer was 5′-ATTCGGGATCCCAGCGGCTCAA-3′, and the reverse primer was 5′-TGGGGTACCTCACTCGTGGACGT-3′. GAL4-pGL4-luc plasmid was constructed by inserting the 5×GAL4 response elements into the promoter region of the pGL4.17 reporter vector (Promega) as described previously19 (link).
Mutations in pBIND-LXRβ-LBD were created by site-directed mutagenesis using the Fast Mutagenesis System (TransGen Biotech, Beijing, China). Several key amino acids were changed to alanines in LXRβ-LBD. The mutated plasmids were generated as follows: F271A (Phe271 to Ala) and T316A (Thr316 to Ala).
Mutations in pBIND-LXRβ-LBD were created by site-directed mutagenesis using the Fast Mutagenesis System (TransGen Biotech, Beijing, China). Several key amino acids were changed to alanines in LXRβ-LBD. The mutated plasmids were generated as follows: F271A (Phe271 to Ala) and T316A (Thr316 to Ala).
5
Cloning and Expression of Nkx6.3 Domains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full open reading frame of XNkx6.3 and that without the eh1 domain coding region were cloned into pCS2-GR vector to create the Nkx6.3GR and Nkx6.3HDCGR constructs. The VpHDCGR construct was prepared by cloning the HDCGR fragment into a VP16 expression vector [49] (link). Different fragments XNkx6.3 were cloned into the pBIND vector (Promega), which contains the yeast GAL4 DNA-binding domain, for the expression of GAL4 fusion proteins with different XNkx6.3 domains.
6
miRNA-590-3p Regulation of CFHR3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miRNA-590-3p precursors were transferred into cells by using the Lipofectamine RNAiMAX transfection kit (Invitrogen, USA). The indicated reporter vectors (CFHR3-3’ UTR and CFHR3-3’ UTR MUT vectors) together with miRNA mimics mix were transfected using Lipo2000 (Invitrogen, USA); after transfection for 48 hours, cells were harvested to analyze. The pBIND vector (#E2440, Promega, USA) was used as the internal reference; the renilla luciferase signal was used for normalizing the firefly luciferase signal. Luciferase activity was determined using the dual-luciferase reporter system (Promega, USA) for 3 trials at least.
7
PPARγ-LBD Transactivation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pBIND-PPARγ-LBD plasmid was constructed by cloning the PPARγ ligand-binding domain (LBD) (amino acids 172-476) PCR products into the pBIND vector (Promega, Madison, WI, USA), which fused with the GAL4 DNA-binding domain. The GAL4-pGL4-luc reporter plasmid was constructed by inserting the 5 GAL4 response elements into the promoter region of the pGL4.17 reporter plasmid (Promega). The pRL-TK Renilla luciferase vector was purchased from Promega. The human hepatoma HuH-7 cell line was obtained from the Health Science Research Resources Bank (JCRB0403; Osaka, Japan). All transfections were performed with the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.
8
Mutational Analysis of Human PPARγ-LBD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA). All medium and serum were obtained from Gibco (Invitrogen). The wild-type gene of human PPARγ-LBD (amino acids 172–476) was obtained by PCR and cloned into pBIND vector (Promega). Mutations in pBIND-PPARγ-LBD were created by site-directed mutagenesis using the Fast Mutagenesis System (TransGen Biotech, Beijing, China).
9
Cloning and Mutagenesis of ERK5 Constructs
10
Cloning and Expression of TRAF-RelA Fusion Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Gal4-TRAF and RelA fusion protein constructs were generated by cloning the individual TRAF and RelA cDNAs into the pBind vector (Promega). The TRAF constructs that were used for cotransfection with Gal4-tagged RelA were developed by cloning the individual TRAF cDNAs into the pCMV-Tag2B vector (Stratagene). Each of the cDNAs were amplified from the whole genome cDNA library (Promega) by polymerase chain reaction and sequenced. The TRAF2 N-terminal RING-finger deletion (ΔN-TRAF2) constructs were generated by removing a 261-bp DNA fragment corresponding to the N-terminal 87 amino acids of TRAF2 [22 (link)]. Cells were transfected using Lipofectamine 2000, according to the manufacturer’s instructions (Invitrogen).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!