Qubit 2.0 fluorometer

Total RNA was extracted with NucleoSpin RNA Plus XS (Macherey–Nagel GmbH & Co) from the 9 samples following the manufacturer’s instructions. Total RNA sample integrity and concentration was measured by Agilent High Sensitivity RNA ScreenTape Assay (Agilent 2200 TapeStation system, Agilent Technologies, Inc., Santa Clara, US). Sample concentrations for quantification were determined by Qubit 2.0 Fluorometer (Thermo Fisher Scientific Inc., Waltham, USA). During extraction, genomic DNA was removed by gDNase during on-column DNA digestion. The purified RNA was dissolved in 20 µL RNase-free water and stored at − 80 °C. The cDNA was generated and amplified in 9 cycles with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio, Inc. Mountain View, USA). Libraries were generated (Nextera XT DNA Library Prep Kit, Illumina, San Diego, USA) and sample quality was checked by Agilent 2100 Bioanalyzer (Agilent, Santa Clara, USA) and by Agilent High Sensitivity D1000 ScreenTape Assay (Agilent 2200 TapeStation system). Custom index primers were tagged to the libraries to allow for multiplexing during RNA-sequencing. Libraries were quantified, normalised based on measurements determined by Qubit 2.0 Fluorometer, and sequenced on the Illumina NextSeq 500 system (150 cycles). The raw RNA-Seq data was deposited and released with the BioProject accession number of PRJNA635095.

Bisulfite-converted DNA was amplified in two steps of amplification. The first PCR was performed using FastStart High Fidelity PCR Systems (Roche) and the following primers were added to the primer sequences for the annealing of Nextera XT Index (Illumina) in the second step of PCR: BDNF—FW: 5′ gaatgtgaaTaaaaatgtTaaaag 3′; RV: 5′ taatAAactcccatAactAaA 3′ Tph1A—FW: 5′ atttgTtgtTaggaggaagattaag 3′; RV 5′ cacaacatcaaattctctacat 3′. We used some specific upstream adapters (FW: 5’ tcgtcggcagcgtcagatgtgtataagagacag 3’; RV: 5’ gtctcgtgggctcggagatgtgtataagagacag 3′). Both PCR steps were followed by the purification of amplicons with Agencourt AMPure XP beads (Beckman Coulter Genomics). Amplicons were quantified using Qubit^® 2.0 Fluorometer and the library was diluted to a final concentration of 8pM. Phix control libraries (Illumina) were combined with the normalized library (10% (v/v)) to increase the variability of base calling during sequencing. The amplicons’ library was subjected to sequencing using V2 reagent kits on the Illumina MiSeq system (Illumina). Paired-end sequencing was performed in 251 cycles per read (251 × 2). An average of approximately 100,000 reads/sample were obtained.

The RNA extracted from blood was sequenced at the UCSD Institute for Genomic Medicine. The quality of the RNA was assessed using the Tapestation 2200 (Agilent) and Libraries prepared using TruSeq Library prep kits (Illumina), and then run on the Tapestation high-sensitivity DNA assay kits to ensure the correct library size. Libraries were quantified using the Qubit^® 2.0 Fluorometer, pooled, and run on the Illumina NovaSeq 6000 (Illumina). Reads were mapped to the mouse transcriptome using Bowtie2 algorithm [18 (link)] and counted as reads per gene using RSEM [19 (link)] and then analyzed using the statistical algorithm limma (RRID:SCR_013027). RNA-sequencing data have been archived in the Gene Expression Omnibus (GEO) database GSE157438 (RRID:SCR_005012). Human RNA-seq data were obtained from a previous published study where blood samples were sequenced from patients before three months of treatment with antipsychotics [20 (link)]. This study conformed to the international standards for research ethics and was approved by the Cantabria Ethics Institutional Review Board (IRB).

RNA extraction and sequencing was performed as previously described^{85 (link)–87 (link)}. Briefly, total RNA was isolated using TRIzol (Invitrogen) according to the manufacturer’s instructions. The quality of the RNA was assessed using the Tapestation 2200 (Agilent) and Libraries prepared using TruSeq Library prep kits (Illumina), and then run on the Tapestation high sensitivity DNA assay kits to ensure correct library size. Libraries were quantified using the Qubit® 2.0 Fluorometer, pooled and run on the Hiseq 2500 (Illumina). Reads were mapped to the mouse transcriptome using Bowtie2 algorithm^{88 (link)} and counted as reads per gene using RSEM^{89 (link)} and then analyzed using the statistical algorithm limma. Genes were then sorted by their posterior error probability (local false discovery rate, FDR). We also express significance of a gene as the q value, which is the smallest false discovery rate at which a gene is deemed differentially expressed. All RNA-seq data can be found at Gene Expression Omnibus (GEO) database, [http://www.ncbi.nlm.nih.gov/geo] (accession GSE119772).

Total genomic DNA was extracted from the soil samples using the PowerSoil® DNA Isolation Kit (Mobio, USA) in accordance with the manufacturer’s instructions. DNA samples were quantified using a Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA, USA). 30–50 ng DNA was used to generate amplicons using a MetaVx™ Library Preparation kit (GENEWIZ, Inc., South Plainfield, NJ, USA). PCR amplicons of the bacterial 16S rRNA V3 and V4 regions and the fungal conserved ITS1 and ITS2 regions were produced using the primer pairs listed in S1 Table. In addition to the ITS target-specific sequences, the primers also contained adaptor sequences allowing uniform amplification of the library with high complexity ready for downstream NGS sequencing on Illumina Miseq platform.
DNA libraries from samples were constructed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA), and further quantified using Qubit 2.0 Fluorometer [33 (link)], after which they were multiplexed and loaded on an Illumina MiSeq instrument according to the manufacturer’s instructions (Illumina, San Diego, CA, USA). Sequencing was carried out using a 2x300/250 paired-end (PE) configuration; image analysis and base calling were conducted using the MiSeq Control Software (MCS) embedded in the MiSeq instrument [7 (link)].

Faecal samples were collected at the end of experiment and stored at −80 °C until DNA extraction. The stool specimens were then thawed gently on ice, homogenised by manual mixing and weighed according to the recommendations of NucleoSpin^® DNA Stool kit (Machery-Nagel, Düren, Germany). The extractions were performed according to the manufacturers’ instructions. The DNA concentrations of the extracts were measured fluorometrically with the Qubit dsDNA HS assay kit (Thermo Fisher Scientific, Waltham, USA), after which the DNA samples were stored at −20 °C until 16S rDNA library preparation. Faecal DNA samples together with FMT sample were analysed by commercially available NGS service (Novogene Europe, Cambridge, UK). Briefly, hypervariable regions of V3-V4 in bacterial 16S rDNA were amplified using primers 341F (CCTAYGGGRBGCASCAG) and 806R (GGACTACNNGGGTATCTAAT) and subjected to subsequent taxonomic analysis. All PCR reactions were carried out with Phusion^® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, USA). The libraries were generated with NEBNext^® Ultra^TM (New England Biolabs, Ipswich, MA, USA) DNA Library Prep Kit for Illumina, quantified via Qubit 2.0 Fluorometer and sequenced using Illumina Novaseq PE250. The statistical analyses using QIIME, Flash, R, RDP, Blast (ITS), PyNast bioinformatics software were performed by Novogene Europe (Cambridge, UK).

Mycelia and conidia were collected from ground-and ISS-grown JSC-09335008 GMM agar plates. DNA was extracted using the Power Soil DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, California, United States) following the manufacturers protocol. Extracted DNA was checked for quality using Qubit 2.0 Fluorometer and used for paired-end library preparation with TruSeq Nano DNA Library Preparation Kit (Illumina, San Diego, California, United States) followed by WGS at the Duke Center for Genomic and Computational Biology. Samples were sequenced using a HiSeq 4,000 Illumina Sequencer generating 101 base long reads.