For generating AAVs with cDNAs of TSC22D4, alleles (WT, ∆D2, and D2 + TSC) were amplified with the following primer pairs followed by Nhe 1 and Xba 1 digestion and subcloning into pdsAAV-LP1 plasmid (35 (link)): TSC22D4-AAV with Nhe I: forward, gatgctagcgtgtgctggaattctg; TSC22D4-AAV with Xba I: reverse, gcatctagactcgagtcagatggaggg. The successful clones sequenced for confirmation with the following primers: pdsAAV-TSC: forward, ctgataggcacctattggtc; reverse, ccacaactagaatgcagtg. Once the sequence is confirmed, the plasmids were purified using QIAGEN Megaprep kit (#12381) according to the manufacturer’s instructions and sent to Vigene Biosciences (Maryland, USA) for AAV generation, purification, and titration.
Block it adenoviral expression system
The BLOCK-iT adenoviral expression system is a laboratory tool for the efficient delivery and expression of genes in mammalian cells. It provides a method for generating recombinant adenoviruses to enable the expression of desired genes or proteins in target cells.
2 protocols using block it adenoviral expression system
Generating Adeno- and Adeno-Associated Viruses for TSC22D4 Alleles
For generating AAVs with cDNAs of TSC22D4, alleles (WT, ∆D2, and D2 + TSC) were amplified with the following primer pairs followed by Nhe 1 and Xba 1 digestion and subcloning into pdsAAV-LP1 plasmid (35 (link)): TSC22D4-AAV with Nhe I: forward, gatgctagcgtgtgctggaattctg; TSC22D4-AAV with Xba I: reverse, gcatctagactcgagtcagatggaggg. The successful clones sequenced for confirmation with the following primers: pdsAAV-TSC: forward, ctgataggcacctattggtc; reverse, ccacaactagaatgcagtg. Once the sequence is confirmed, the plasmids were purified using QIAGEN Megaprep kit (#12381) according to the manufacturer’s instructions and sent to Vigene Biosciences (Maryland, USA) for AAV generation, purification, and titration.
Adenoviral Transduction of Rat JIP1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!