Rnase free dnase 1 set
The RNase-free DNase I set is a laboratory tool used for the selective degradation of DNA in RNA samples. It contains a purified recombinant DNase I enzyme that is specifically formulated to be RNase-free, ensuring the preservation of RNA integrity during the DNA removal process.
Lab products found in correlation
33 protocols using rnase free dnase 1 set
RNA Purification and Quantification
Transcriptomic Analysis of Thermophilic Deinococcus
Total RNA Purification and Validation
Quantitative RT-PCR Analysis of Bone Morphogenetic Receptor Genes
Nucleic Acid Extraction from Bacterial Cultures
RNA Extraction and Sequencing Protocol
Quantifying Nematode Developmental Transcripts
The ΔΔCt method was used to calculate relative expression among life stages and a portion of the 18S rRNA gene was used as endogenous control to normalize the transcription levels.
Real-time PCR was performed in 20 μl volumes containing 4 ng of cDNA, 10 μl 2 x Fast Start SYBR Green master mix (Roche) and 8 pmol of each specific primer.
The gene-specific primers used were hspHbfor3 (GAGCCTCAGTCACATGCTAC)/3′UTRhspHbrev (TGTGAT CTCTGCGTCATCTCG). The thermal profile for real-time PCR was 10 min at 95°C followed by 40 cycles at 95°C for 30 s, at 58°C for 30 s, and 72°C for 40 s. Dissociation curve analysis of amplification products was performed at the end of each PCR to confirm that only one PCR product was amplified and detected: 1 min at 95°C, 30 s at 55°C and 30 s at 95°C. The real-time experiments were conducted on a Stratagene thermal cycler and fluorescent real-time PCR data were analyzed using MX3000P software.
RNA Extraction and cDNA Synthesis
Quantitative RT-PCR Transcriptional Analysis
Quantifying Arabidopsis Transcriptome with QuantSeq
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!