The largest database of trusted experimental protocols

3 protocols using filamin a

1

Autophagy Regulation and DNA Repair Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Olaparib (Selleckchem, AZD2281), rapamycin (LKT Labs, 53123-88-9), and bafilomycin (Sigma-Aldrich, 88899-55-2) were used. The following antibodies were used for the study: Beta-Actin (AC14) (abcam, AB6276, 1:20000 dilution); Atg16L1 (D6D5) (Cell Signaling, 8089 T, 1:1000 dilution); Atg5 (D5F5U) (Cell Signaling, 12994 S, 1:1000 dilution); Atg12 (D88H11) (Cell Signaling, 4180 S, 1:1000 dilution); Beclin-1 (D40C5) (Cell Signaling, 3495 S, 1:1000 dilution); Atg7 (D12B11) (Cell Signaling, 8558 S, 1:1000 dilution); β-Tubulin (D2N5G) (Cell Signaling, 15115 S, 1:1000 dilution); Filamin A (Cell Signaling, 4762 S, 1:1000 dilution); SP1 (Sigma, PLA0307, 1:5000 dilution); anti-phospho-Histone H2A.X (Ser139) (Sigma-Aldrich, JBW301, 1:2000 dilution); LC3 A/B (D3U4C) (Cell Signaling, 12741 S, 1:750 dilution); phospho-mTOR (Ser2448) (D9C2) (Cell Signaling, 5536 T, 1:1000 dilution); SQSTM1/p62 (Cell Signaling, 5114 T, 1:1000 dilution) and (abcam, ab56416, 1:100 dilution); Rad51 (114B4) (abcam, ab213, 1:750 dilution) and BRCA1 (Sigma Millipore, 07-434, 1:1000 dilution), PARP1 (proteintech, 66250, 1:650 dilution) and PAR/pADR (R&D systems, 4335-MC-100, 1:1000 dilution).
+ Open protocol
+ Expand
2

Vimentin Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
vimentin overexpressed plasmid was purchased from Addgene 31922: pvimentin-PSmOrange with full length of vimentin sequence insertion [56 (link)]. Plasmids of vimentin knockdown were purchased from National RNAi Core Facility Platform in Taiwan:

shLuc: TRCN0000072244, ATCACAGAATCGTCGTATGCA,

shVim #3: TRCN0000029119, GCTAACTACCAAGACACTATT,

shVim #4: TRCN0000029121, GCAGGATGAGATTCAGAATAT.

Cells were transfected by different shVim sequences in a cell population and then selected by Puromycin for two weeks to generate stable clones for further experiment. vimentin overexpressing stable clones were transfected in a cell population and then selected by Neomycin, followed by sorting to purify the vimentin expressing cells.
siRNA were purchased from Thermo (L-003551-00-0005, ON-TARGETplus SMARTpool, Human Vim) combined four siRNA sequences together:

J-003551-06, UCACGAUGACCUUGAAUAA;

J-003551-07, GAGGGAAACUAAUCUGGAU;

J-003551-08, UUAAGACGGUUGAAACUAG;

J-003551-09, GGAAAUGGCUCGUCACCUU.

And the control scramble siRNA sequence was (D-001810-01-05, ON-TARGET plus Non-targeting siRNA #1): UGGUUUACAUGUCGACUAA
The primary antibodies used in the study, were as followed: β1-integrin (BD), GAPDH (Santa Cruz), vimentin (Millipore), vinculin (SIGMA), paxillin (BD), E-cadherin (BD), β-catenin (BD), slug (Cell Signaling), filamin A (Cell Signaling), and p-filamin A (Cell Signaling).
+ Open protocol
+ Expand
3

Western Blot Analysis of Bladder Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
For western blotting, total protein was extracted from mouse bladders and clinical specimens using RIPA lysis buffer (Beyotime, Shanghai, China), and protein concentrations were measured using a Bio-Rad DC Protein Assay Kit (Bio-Rad, Hercules, CA, USA). Fifty micrograms of protein was then loaded onto SDS-PAGE gels and separated before being transferred to PVDF membranes (Merck Millipore, Darmstadt, Germany). After being blocked with 5% bovine serum albumin dissolved in Tris-buffered saline for 2 h, the membranes were incubated with primary antibodies to the following proteins overnight at 4 °C: IL-6 (GeneTex, San Antonio, TX, USA,GTX110527, 1:1000), TNF-α (GeneTex, GTX110520, 1:1000), HCN1 (Abcam, Cambridge, UK, ab84816, 1:1000), HCN2 (Abcam, ab65704, 1:1000), HCN3 (Abcam, ab84818, 1:1000), HCN4 (Abcam, ab69054, 1:1000), Filamin A (Cell Signaling Technology, Beverly, MA, USA, 4762, 1:1000), NEDD4L (Cell Signaling Technology, 4013, 1:1000), α-tubulin (Beyotime, AT819, 1:1000) and GAPDH (Beyotime, AG019, 1:1000). Horseradish peroxidase-conjugated species-specific secondary antibodies (Zhongshan Co., Beijing, China, ZB-2301, ZB-2305, 1:5000) were used to detect the above primary antibodies. The proteins were visualized using ECL Substrate (Millipore, Billerica, MA, USA) and detected using an Image Quant LAS-4000 BioImaging System (GE Healthcare, Stockholm, Sweden).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!