Pcmv n flag

Full-length EGFR was amplified from cDNA. The polymerase chain reaction (PCR) products were cloned into the pCMV-N-Flag (Beyotime, Nantong, China). The cells were seeded in 6-well plates, cultured to 80~90% confluence, and then transiently transfected with the plasmid by using Lipofectamine 3000 (Invitrogen) according to the reverse transfection method provided by the manufacturer.
Duplex oligonucleotides were chemically synthesized and purified by GenePharma (Shanghai, China). The small interfering RNA (siRNA) duplexes used were CTGF, #1, 5′- CACCGCAATACCTTCTGCAGGCTGGACAAGAGATCCAGCCTGCAGAAGGTATTGTTTTTTG-3′. Cells were transfected with siRNA duplexes using Lipofectamine 3000 (Invitrogen) according to the reverse transfection method provided by the manufacturer.

The full-length cDNAs of CgVDAC2 and CgBak were sub-cloned using In-Fusion HD Cloning Kit (TaKaRa, Shiga, Japan) into the mammalian expression vectors pCMV-N-Myc and pCMV-N-Flag (Beyotime, Jiangsu, China), respectively, according to the manufacturer’s instructions. To investigate the subcellular localization of CgVDAC2, the pEGFP-N1-CgVDAC2 plasmid was constructed using In-Fusion HD Cloning Kit (TaKaRa, Shiga, Japan). The pEGFP-N1-CgBak plasmid was also constructed using the same kit for the overexpression experiments in HEK293T cells. In addition, CgVDAC2 and CgBak were sub-cloned into the two-hybrid plasmids pGADT7 and pGBKT7 (TaKaRa, Shiga, Japan), respectively, and used in the yeast two-hybrid system.

HA tagged plasmid PKN2-WT was constructed by ligating full-length open reading frame (ORF) of wild type PKN2 (1-936aa, Homo sapiens) and cloned into a expression vector pCMV-N-HA (Beyotime Biotech). PKN2-K686R plasmid was generated by PKN2-WT plasmid with a K686R point mutation at the ATP binding site. The expression vector pCMV-N-HA was used as control. The expression vector pCMV-N-flag (Beyotime Biotech) was used to construct plasmids that encode wild type DUSP6 with a N-terminal flag tag. pCMV-DUSP6-WT expression plasmid was generated by ligating full-length open reading frame of DUSP6 (1-381aa, Homo sapiens) into pCMV-N-flag. The truncation mutant plasmids of DUSP6 were generated by ligating part of DUSP6’s ORF into pCMV-N-flag (150-205aa; 1-205aa; 1-150, 205-381aa). The flag tagged plasmids containing full-length ORF of Elk-1 and CREB were purchased from Vigene Biosciences. The luciferase reporter plasmids were generated by ligating -1500 bp~0 bp of the promoter sequences of IL4 and IL10 into the pGL3-ENHANCER plasmid (Promega Corp.). pRL-TK Vector was purchased from Promega.

MSCV-IRES-GFP, MSCV-ICN1-IRES-GFP and MSCV-ShRNA-ICN1-IRES-GFP were kindly provided by Professor Hudan Liu, Medical Research Institute, Wuhan University, Wuhan, China. pLVX-ShRNA1, pLVX-ShRNA2 and pLVX-IRES-ZsGreen vectors were purchased from Clontech Laboratories. Hemagglutinin (HA)-Ubiquitin, pMD2.G, psPAX2 and pCL-Eco were purchased from Addgene. pCMV-Blank, pCMV-N-MycTag and pCMV-N-Flag were purchased from Beyotime Biotechnology. A modified pLVX-ShRNA2-mCherry vector in which the ZsGreen fluorescent marker was replaced by an mCherry fluorescent marker was made using HiFi DNA Assembly Master Mix (NEB, Cat No. E2621L). ShSIRT1 and ShScramble were cloned into pLVX-ShRNA2-mCherry. ShScramble, ShMYC and Shp27-human were cloned into pLVX-ShRNA2. The SIRT1 coding region was cloned into pCMV-N-MycTag, pCMV-N-Flag and pLVX-IRES-ZsGreen. Mutant SIRT1-H363Y vector was generated using Q5® site-directed mutagenesis kit (NEB, Cat No. E0554). Sanger sequencing of the SIRT1-H363Y plasmid verified the presence of the desired mutation (Fig. S3a). CDK2, SKP2, MYC and mCherry were cloned into pCMV-Blank. CDK2 and p27 were cloned into pCMV-N-Flag. Shp27-mouse and ShRen were cloned into MSCV-ShRNA-ICN1-IRES-GFP.

Trans 5α was purchased from Transgen Biotech (Transgen, Beijing, China). Plasmids including pCMV-C-EGFP (#D2626), pCMV-C-DsRed (#D2624) and pCMV-N-FLAG (#D2722) were purchased from Beyotime (Beyotime, Nanjing, China).