Cells and tumor specimens were lysed with RIPA Lysis Buffer (Beyotime Institute of Biotechnology). Equivalent amounts of protein sample were separated by 10% SDS‐PAGE and transferred to PVDF membranes (Millipore, Billerica, MA). After incubated with 5% skim milk in TBST, the membranes were incubated with rabbit primary antibodies (Abcam, Cambridge, MA) against TGFβI (ab170874), VEGFA (ab52917), Vimentin (ab92547), Ki67 (ab16667), cleaved caspase‐3 (ab13847), E‐cadherin (ab40772), N‐cadherin (ab76011), and Snail (ab82846), respectively at 4℃ overnight. Then, incubated with HRP‐conjugated secondary antibodies (ab6721) at room temperature for 1.5 hours. Finally, the blots were visualized by ECL and detected using a ChemiDoc XRS imaging system. GAPDH was used as a loading control.
Primary rabbit antibody
Manufactured by Abcam
Sourced in United Kingdom, United States, China, France
Primary rabbit antibodies are immunoglobulin proteins produced by rabbits that can be used as research tools to detect and bind to specific target antigens. They serve as essential components in various immunoassays and experimental techniques.
Automatically generated - may contain errors
Lab products found in correlation
Pvdf membrane, by Merck Group (4 mentions)
Rabbit primary antibody, by Thermo Fisher Scientific (4 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (4 mentions)
Ab8227, by Abcam (3 mentions)
Ripa lysis buffer, by Beyotime (2 mentions)
Protease inhibitor cocktail, by Thermo Fisher Scientific (2 mentions)
Mini protean tgx stain free, by Bio-Rad (2 mentions)
Supersignal west pico chemiluminescent substrate, by Thermo Fisher Scientific (2 mentions)
Chemidoc mp, by Bio-Rad (2 mentions)
Image analysis system, by Bio-Rad (2 mentions)
Ab196495, by Abcam (2 mentions)
Protease inhibitor, by Boster Bio (2 mentions)
Ab226939, by Abcam (2 mentions)
Ab205719, by Abcam (2 mentions)
Ab49822, by Abcam (2 mentions)
Ab32503, by Abcam (2 mentions)
Ab45036, by Abcam (2 mentions)
Ab7780, by Abcam (2 mentions)
Ab6721, by Abcam (2 mentions)
Protease and phosphatase inhibitor, by Thermo Fisher Scientific (2 mentions)
23 protocols using primary rabbit antibody
1
Western Blot Analysis of Tumor Markers
2
Quantification of Interleukin Expression in Tumor Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tumor tissues of three randomly chosen mice per group were fixed in 4% formaldehyde, embedded in paraffin, and sectioned. Immunostaining was carried out with rabbit primary antibodies (Abcam, Inc., Shanghai, China) against three different interleukins, i.e., IL-27-A, IL-5RA, and IL-9, respectively. The secondary antibody was a goat anti-rabbit horseradish peroxidase-linked immunoglobulin (Cell Signaling Technology, Inc., Shanghai, China). The DAB Horseradish Peroxidase Color Development Kit (Beyotime, Beijing, China) was used for reacting with the sections for color development. Stained sections were imaged with Leica Aperio CS2 system (Leica, Wetzlar, Germany). Positive signals of immunostaining of histological sections were quantified by using ImageJ (three mice per group, two replicates per mouse per staining). Data are presented as average optical density.
3
Quantitative Protein Analysis in Cell Lysates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue lysates and cell lysates were prepared using RIPA buffer (Solarbio, China) to obtain total proteins. Proteins (50 µg) were separated on SDS-PAGE and transferred on polyvinylidene fluoride (PVDF) membranes (Millipore, USA). The membranes were blocked with 5% (w/v) skimmed milk solution for 1 h, and incubated with rabbit primary antibodies (Abcam) against sFlt-1, PlGF, SIRT1, eNOS and GAPDH at 4°C for 12 h. Next, the membranes were washed and incubated with appropriate anti-rabbit HRP-conjugated secondary antibodies at 37°C for 1 h. Protein bands were detected using chemiluminescence and band intensities were analyzed using Quantity One software 4.6.2 (Bio-Rad, Hercules, CA, USA).
4
Western Blot Analysis of Autophagy and Drug Resistance Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed with RIPA Lysis Buffer (Beyotime Institute of Biotechnology). Equivalent amounts of protein sample were separated by 10% SDS-PAGE and transferred to PVDF membranes (Millipore, Billerica, MA, USA). After incubating with 5% skim milk in TBST, the membranes were incubated with rabbit primary antibodies (Abcam, Cambridge, MA, USA) against ATG7 (ab133528), LC3A/B (ab62721), P62 (ab155686), multidrug resistance protein 1 (MRP1, ab3368), lung resistance-related protein (LRP, ab92544), GST (ab19256), and Topoisomerase-II (TOPO-II, ab52934), respectively, at 4°C overnight. Then, they were incubated with HRP-conjugated secondary antibodies (ab6721) at room temperature for 1.5 hours. Finally, the blots were visualized by electrochemiluminescence (ECL) and detected using a ChemiDoc XRS imaging system. GAPDH was used as a loading control.
5
Immunoblotting and Immunoprecipitation of Mesangial Cell Lysates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh tissues and cell cultures were extracted for lysates with the addition of protease inhibitor cocktail (Thermo Scientific, Waltham, MA, USA). Lysate samples were run in gel at denatured and reduced condition and then transferred to a PVDF membrane (EMD Millipore, Billerica, MA, USA). The rabbit primary antibodies (2 µg/ml; Abcam) and horseradish peroxidase-goat anti-rabbit IgG (2 µg/ml; Southern Biotech) were applied in order. The band intensities were quantitated by ImageJ 1.61u software (National Institutes of Health, Bethesda, MD, USA) and normalized to β-actin values accordingly. The intensities of blank groups were set as 1 (baseline), and the relative intensities were calculated in other groups.
By using a protein G kit (Roche, Indianapolis, IN, USA), immunoprecipitation was performed with the lysates of mesangial cells. Briefly, lysates were mixed with anti-DNA IgG (or control) and then incubated at 4°C overnight. Protein G suspension was added to the mixtures. The supernatants were discarded after centrifuging while the pellets were re-suspended, followed by Western blotting.
By using a protein G kit (Roche, Indianapolis, IN, USA), immunoprecipitation was performed with the lysates of mesangial cells. Briefly, lysates were mixed with anti-DNA IgG (or control) and then incubated at 4°C overnight. Protein G suspension was added to the mixtures. The supernatants were discarded after centrifuging while the pellets were re-suspended, followed by Western blotting.
6
Western Blot Analysis of Autophagy and Inflammation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell lysates were prepared using lysis buffer (Solarbio, China) with phenylmethylsulfonyl fluoride (PMSF; Solarbio, China). 10% sodium dodecyl sulfate-polyacrylamide gels were used to split the sample proteins and transferred on polyvinylidene fluoride membranes (Millipore, USA). The membranes were blocked with 5% (w/v) skimmed milk solution for 1 h, and incubated with rabbit primary antibodies (Abcam) against LC3II(1:2000), p62(1:50000), LOX-1(1 μg/mL), VCAM-1(1:10000), MCP-1(1:5000) and mouse primary antibodies against β-actin (1:2000) at 4 °C for 12 h. After that, TBST was used to wash the membranes three times, 15 min a time and then incubated with secondary antibodies for 1 h. Immune complexes were detected by MiniChemi (Beijing Sage Creation Science, China).
7
Evaluating Renal Fibrosis and Tissue Remodeling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Paraffin-embedded sections (3 μm) of renal cortical samples were examined under blinded conditions by a pathologist and a nephrologist. As described previously, the level of tubulo-interstitial fibrosis were investigated using Sirius red staining [24 (link)] and tissue remodeling by immunohistochemical assessment of vimentin expression (1/500, Cell Marque, Rocklin, CA, USA).
Frozen cortex sections (5 μm) were used to investigate LOX-1 and TGFβ expression by double immunofluorescence localization. We used a rabbit primary antibody at 1/100 (Abcam, Paris, France) and a goat anti-rabbit secondary antibody coupled to Alexa 488 fluorochrome (1/1000, Life Technologies, Saint Aubin, France) for LOX-1 expression and a mouse primary antibody at 1/100 (Santa Cruz, CA, USA) and a goat anti-mouse secondary antibody coupled to Alexa 568 Fluorochrome (1/1000, Life Technologies) for TGFβ.
Frozen cortex sections (5 μm) were used to investigate LOX-1 and TGFβ expression by double immunofluorescence localization. We used a rabbit primary antibody at 1/100 (Abcam, Paris, France) and a goat anti-rabbit secondary antibody coupled to Alexa 488 fluorochrome (1/1000, Life Technologies, Saint Aubin, France) for LOX-1 expression and a mouse primary antibody at 1/100 (Santa Cruz, CA, USA) and a goat anti-mouse secondary antibody coupled to Alexa 568 Fluorochrome (1/1000, Life Technologies) for TGFβ.
8
Quantitative Immunoblotting of ER Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein concentration was quantitated with the BCA protein assay kit (Thermo Scientific). Equal quantities of proteins from each fraction were separated by SDS-PAGE (Bio-Rad Mini-PROTEAN® TGX Stain-Free™), transferred onto a PVDF membrane, blocked with 5% milk in TBS-Tween, and detected with the indicated primary antibodies incubated over-night at 4°C followed by incubation for 1 hr with the appropriate HRP-linked secondary (either mouse or rabbit) at a 1:6000 dilution. For IP3R1, 20 μg protein was loaded, rabbit primary antibody (Invitrogen) was used at 1:2000. For IP3R3, 20 μg protein was loaded, mouse primary antibody (BD Biosciences) was used at 1:4000. For CRT, 10 μg of protein was loaded, mouse primary antibody (BD Biosciences) was used at 1:6000. For CNX, 10 μg of protein was loaded, mouse primary antibody (Santa Cruz) was used at 1:2000. For ANT, 40 μg protein was loaded, mouse primary antibody (Abcam) was used at 1:1000. For VDAC, 40 μg of protein was loaded, rabbit primary antibody (Thermo-Fisher) was used at 1:1000. For BOK, 20 μg of protein was loaded, rabbit primary antibody (Abcam) was used at 1:5000. The PVDF membrane was visualized with SuperSignal® West Pico Chemiluminescent Substrate (Thermo Scientific) or Kindle Biosciences KwikQuant using a Bio-Rad ChemiDoc MP.
9
ChIP Protocol for Primary Chondrocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary chondrocytes were cultured until confluence in 12-well plates (106 cells per well). During the cultures, cells were maintained in a humidified incubator containing 5% CO2 at 37°C and 1% of oxygen. Fixation of cultured cells and their processing for chromatin immunoprecipitation (ChIP) followed the manufacturer’s instructions (Abcam). Immunoprecipitation with Pierce protein A/G magnetic beads followed the manufacturer’s instructions (Thermo Fisher Scientific, Villebon-sur-Yvette, France). Immunoprecipitation and detection involved a rabbit primary antibody (Abcam, France) and rabbit immunoglobulin (IgG) antibody (Diagomic, Blagnac, France). Results are average Ct values reported to input Ct values. The following primer sequences were used: site 1, 5′ACACCAGCTTCGTTGAACCAGAG3′ (forward) and 5′GGAAGCAAATGTTTGGGTGACTCA3′ (reverse); site 2, 5′ACTTGTCAGTTCAAGGTCGGCGTC3′ (forward) and 5′TGTGGTGACTGGAGCTTCTGCTG3′ (reverse); and site 3, 5′CGAGCTTTTCAAAAGCATCCCAAAGA3′ (forward) and 5′TGATAAAGCGAATCGGCCTGTATC3′ (reverse).
10
Retinal Ganglion Cell Labeling in Rotenone-Induced Retinal Degeneration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eyes were dissected from SD rats seven days after intravitreal injection of rotenone alone or together with Ntf5 recombinant proteins and were fixed with 4% paraformaldehyde in PBS overnight at 4 °C. Fixed eyes were embedded in optimal cutting temperature compound (Sakura Finetek Japan, Tokyo, Japan) and were cut into 10 µm-thick sections using a cryostat CM3050S (Leica Biosystems, Wetzlar, Germany). Immunostaining of retinal sections was performed as reported before69 (link). Briefly, retinal sections were treated with blocking solution (10% normal donkey serum in PBS containing 0.01% Tween 20), followed by treatment with rabbit primary antibody (Abcam, Cambridge, UK; 1:500 dilutions with blocking solution) for RNA-binding protein with multiple splicing (RBPMS), which is a selective marker for retinal ganglion cells70 (link). After extensive washing, retinal sections were incubated with Cy3-conjugated anti-rabbit IgG antibody (Jackson ImmunoResearch, West Grove, PA, USA; 1:500 dilutions with blocking solution) and 4′,6-diamidino-2-phenylindole (DAPI; Dojindo, Kumamoto, Japan). To visualize the inner nuclear layer (INL) cells, retinal sections were stained with hematoxylin and eosin (HE; Muto Pure Chemicals, Tokyo, Japan).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!