Conservation of the LGR5 gene and its promoter was assessed using evolutionary conserved region browser and multiple alignments of several vertebrate genomes. The human LGR5 gene is located on chromosome 12 and has a conserved region upstream of the main promoter. This gene segment [LGR5 promoter element (983 bp)] was amplified from RP11-59F15 bacterial artificial chromosome clones (obtained from the Australian Genome Research Facility, Ltd., Melbourne, Australia) by polymerase chain reaction (PCR) (Supplementary Figure 1A ) using a set of primers (Table 1 ). Sequences for specific restriction sites (Nde I, Nhe I, Sac I, and Xho I) were added to allow the insertion of the amplicon into the pEYFP-N1 vector (Clontech, Mountain View, CA, United States). Subsequently, this purified deoxyribonucleic acid (DNA) fragment was A-tailed and ligated into pGEM®-T Easy Vector System I (Madison, WI, Promega). White colonies were selected and plasmid DNA isolated, purified, and sequenced. Verified plasmids containing the DNA of interest, which is also free of PCR-introduced mutations, were then digested and ligated into the pEYFP-N1 vector. A negative control clone was constructed by the deletion of the promoter insert from the promoter-pEYFP-N1 clone. The original pEYFP-N1 vector (Clontech) with the CMV promoter was used as a positive control.
Peyfp n1 vector
Manufactured by Takara Bio
Sourced in United States, Germany, Japan
The PEYFP-N1 vector is a plasmid designed for the expression of enhanced yellow fluorescent protein (EYFP) in mammalian cells. It contains the necessary regulatory sequences for efficient protein expression and the EYFP coding sequence. The EYFP protein can be used as a fluorescent marker to monitor gene expression or subcellular localization in live cells.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions)
Quikchange mutagenesis kit, by Agilent Technologies (3 mentions)
Prluc n1, by PerkinElmer (3 mentions)
Ptarget, by Promega (2 mentions)
Pgem t easy vector system 1, by Promega (1 mentions)
Kod plus mutagenesis kit, by Toyobo (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Dna sequencing, by Macrogen (1 mentions)
Pecfp n1, by Takara Bio (1 mentions)
Pgem t easy vector, by Enzynomics (1 mentions)
Pcdna3, by Thermo Fisher Scientific (1 mentions)
Bamhi, by New England Biolabs (1 mentions)
Library efficiency dh5α competent cells, by Thermo Fisher Scientific (1 mentions)
Ecori, by New England Biolabs (1 mentions)
Opti mem 1, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Pcdna3 vector, by Thermo Fisher Scientific (1 mentions)
Quickchange site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Pfuultra, by Agilent Technologies (1 mentions)
Pcdna3.1 hygro, by Thermo Fisher Scientific (1 mentions)
31 protocols using peyfp n1 vector
1
Cloning and Characterization of LGR5 Promoter
2
Constructing Truncated FILIP Expression Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length rat L-FILIP cDNA was amplified using polymerase chain reaction (PCR) and was inserted into the pCAGGS vector [18 (link)], which contains 3 x FLAG and IRES-GFP sequences. The PCR primers for the construction of full-length FILIP were as follows (listed 5’ to 3’): gcagatctggtgggaatgagatcacgaaatcaagg and cggatatcccttcccccctccaagaga. The control vector was the empty pCAGGS vector expressing IRES-GFP (pCAGGS IRES-GFP). The vectors expressing the truncated forms of FILIP were constructed using the KOD-plus-mutagenesis kit (Toyobo, Tokyo, Japan) based on the 3 x FLAG tagged full-length FILIP expression vector (pCAGGS FILIP IRES-GFP). The primers for the truncated forms of FILIP were as follows (listed 5’ to 3’): FILIP d248-442, gagggcgaaggacttgagcttcac and cggagtaagtcggaatgcacccag ; FILIP d248-685, gagggcgaaggacttgagcttcac and caaatggccaagcacaaagccata ; FILIP d934-1111, ctcttcagatgtggggcttgtgat and aggaaccacctctcttcaagaccc ; FILIP d872-1111, ccaaggaatccaagacttcctca and aggaaccacctctcttcaagaccc ; and FILIP d687-960, tcgcaaaagcccaaaagtgca and ttggtgtttgatttcctcgag . A schematic depicting each mutant is shown in S1 Fig . For the enhanced yellow fluorescent protein (EYFP)-tagged FILIP expression vector, the full-length rat L-FILIP cDNA was inserted into the pEYFP N1 vector (Takara Bio Inc., Kusatsu, Japan).
3
Fluorescent Protein Expression Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EB1-YFP was previously described (Gu et al., 2006 (link); Gu and Gu, 2010 (link); Barry et al., 2014 (link)). YFP-MAP2 was made by subcloning the MAP2 cDNA into the pEYFP-N1 vector (Takara Bio Inc.). Mito-YFP was purchased from Takara Bio Inc. NSTOP-GFP was provided by C. Bosc and A. Andrieux (University Grenoble Alpes, Grenoble, France). TRPV4 was a gift from B.M. Spiegelman and L. Ye (Harvard University, Cambridge, MA). TRPV1 was purchased from OpenBiosystem. All constructs were confirmed by sequencing.
4
Construction of Lyn-CFP and Lyn-YFP Biosensors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lyn-CFP and Lyn-YFP were generated by PCR amplification using cDNA of LDR (a kind gift from Takanari Inoue) as a template. A pair of primers was designed: forward 5′-CTTCGAATTCCGGCCACCATGGGATG-3′ and reverse 5′-CGGTGGATCCGCGCTGTCTTTCC-3′, which contained EcoR1 and HamH1 restriction sites, respectively. The amplified and purified PCR product was ligated into the pGEMT-Easy vector (Promega) to improve the efficiency of ligation of PCR products. The pGEMT-Easy vector containing Lyn insert was digested with EcoR1 and BamH1 (Enzynomics) and ligated with the pECFP-N1 or pEYFP-N1 vector (Clonetech) by T4 DNA ligase (NEB). Lyn-CFP and Lyn-YFP constructs were verified by DNA sequencing (Macrogen) before use.
5
Cloning and Expression of cA3 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cA3 in the pCR-TOPO-II vector was restricted with BamHI (New England BioLabs) and EcoRI (New England BioLabs) restriction endonucleases. PCR primers were designed to introduce HindIII recognition site at the 5′ end of the gene and AgeI recognition site at the 3′end of the gene which eliminated the stop site. The PCR primers are 5′- CGGAAGCTTGCAGAGATGGCCAAGATTAACACCCAAGTCTCC-3′ and 5′-GGCGACCGGTGACTGCTCTTTGATCTCTGTTTTTGCGGC-3′ . The pEYFP-N1 vector (Clonetech) was prepared for ligation by digesting with HindIII and AgeI. The PCR gene product was ligated into the pEYFP and the product was used to transform Library Efficiency® DH5α Competent Cells (Invitrogen). DNA sequencing confirmed the full length gene product in the pEYFP-N1vector. The hB3 gene, a gift from Bernd Wissinger, was cloned into pCDNA 3.1 (Invitrogen) for eukaryotic expression. Attempts to clone this gene into pEYFP-C1 or pEYFP-N1 to examine the cellular localization of the fluorescent tag resulted in the failure of heteromeric channel expression when co-expressed with untagged cA3. For this reason, all heteromeric channel studies were comprised of cA3 in pEYFP co-expressed with human hB3 in pcDNA3.1. Mutations were generated using primers designed with point mutations; mutagenesis was accomplished using QuikChange® (Stratagene, San Diego, CA). Full-length sequences were obtained for all mutant cDNAs.
6
Engineered Orai1 Mutants for SOCE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Orai1 mutants employed for electrophysiology were engineered into a pEYFP-N1 vector (Clonetech) to produce C-terminally tagged Orai1-YFP proteins (Navarro-Borelly et al., 2008 (link)). mCherry-STIM1 and CFP-CAD were kind gifts of Dr. R. Lewis (Stanford University, USA). All mutants were generated by the QuikChange Mutagenesis Kit (Agilent Technologies) and the mutations were confirmed by DNA sequencing. For electrophysiology, the indicated Orai1 constructs were transfected into HEK293-H cells either alone (200 ng DNA per coverslip) or together with STIM1 (100 ng Orai1 and 500 ng STIM1 DNA per coverslip). For FRET microscopy experiments, cells were transfected with Orai1-YFP and CFP-CAD constructs (100 ng each per coverslip). All transfections were performed using Lipofectamine 2000 (Thermo Fisher Scientific) 24–48 hours prior to electrophysiology or imaging experiments.
7
Overexpression and silencing of RARRES1 and AGBL2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Codon-optimized full-length human RARRES1 cloned into BglII and HindIII sites in the pEYFP-N1 vector (Clonetech) and pGlue vector were provided by Genscript. AGBL2 (CCP2; Myc-DDK-tagged) construct was from Origene Technologies, Inc. (Cat #RC206949). ON-TARGETplus SMARTpool Human RARRES1 (Cat #L-009925-00), siGENOME SMARTpool Human AGBL2 (CCP2) (Cat #M-012937-00) and Non-Targeting control siRNA (Cat #D-001210-01-20) were from Thermo Scientific Dharmacon. Cells were seeded at 100,000 cells per well in 6-well plastic tissue culture dishes on day 0. On day 1, for each cell sample, 7.5μl of Lipofectamine 3000 (Invitrogen, Carlsbad, CA) was added to 125μl of OPTI-MEM I (Gibco-Invitrogen, Grand Island, NY) in a sterile eppendorf tube, and mixed. 2.5μg of DNA or 75pmol of siRNA in 125ul of OPTI-MEM were added with or without 5ul of P3000, mixed, and incubated for 5 minutes at room temperature. The mixture was then added dropwise to cells.
8
Engineered Mammalian cSOD1 Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A mammalian expression plasmid of FLAG-tagged cSOD1 at the C terminus was generated and subcloned into a pcDNA3 vector (Thermo Fisher Scientific) as described previously (37 (link)). cSOD1 cDNA was gifted by Prof. Makoto Urushitani (Shiga University of Medical Science). Then, the WT and E40K cSOD1 cDNAs were also subcloned into a pEYFP-N1 vector (Clontech Laboratories Inc) or a pCI-neo untagged vector (Promega) using seamless ligation cloning extract reaction (38 (link)). Based on these untagged, FLAG-, or EYFP-tagged WT and E40K cSOD1, various cSOD1 mutants were generated by site-directed mutagenesis. Similarly, human mutant SOD1 cDNAs cloned in pEYFP-N1 or pCI-neo were generated by site-directed mutagenesis of WT hSOD1. For human/canine chimeric SOD1s, each canine exon and the plasmid vector encoding hSOD1 were synthesized by standard PCR strategies with oligonucleotides, and then an exon of hSOD1 was replaced with the corresponding canine exon using seamless ligation cloning extract reaction. All human/canine chimeric SOD1s were subcloned into the pEYFP-N1 vector. All cDNAs were verified by sequencing prior to their use. Experiments using recombinant DNA were approved by the recombinant DNA experiment committee of Nagoya University.
9
Pendrin Functional Characterization and Localization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pTARGET (Promega Corporation, Madison, WI, USA) vector, containing the cDNA of wild type or mutated human pendrin [9 (link)], was used for functional tests.
The pEYFPN1 vector (Clontech, Mountain View, CA, USA), containing the cDNA of wild type or mutated human pendrin, was used for co-localization and determination of pendrin expression levels via imaging. Following transfection of this construct in cells, pendrin is produced with the enhanced yellow fluorescent protein (EYFP) fused to its C-terminus [27 (link)].
Sequence alterations in the cDNA of pendrin were obtained using the QuikChange® site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) and the primers listed in theTable S6 .
The sequence of all plasmid inserts was verified by Sanger sequencing (Microsynth AG).
The pEYFPN1 vector (Clontech, Mountain View, CA, USA), containing the cDNA of wild type or mutated human pendrin, was used for co-localization and determination of pendrin expression levels via imaging. Following transfection of this construct in cells, pendrin is produced with the enhanced yellow fluorescent protein (EYFP) fused to its C-terminus [27 (link)].
Sequence alterations in the cDNA of pendrin were obtained using the QuikChange® site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) and the primers listed in the
The sequence of all plasmid inserts was verified by Sanger sequencing (Microsynth AG).
10
Directed Mutagenesis of Gerbil Prestin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single or multiple amino acid substitutions were generated using QuickChange II or QuickChange II Multi site-directed mutagenesis kits (Stratagene, La Jolla, CA) with a gerbil prestin-YFP in pEYFPN1 vector (Clontech, Mountain View, CA) as a template. All mutations were confirmed by DNA sequencing, including the entire coding region.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!