4T1 cells or tumor samples were lysed in TNEN buffer containing proteinase inhibitor cocktail. Proteins were then denatured at 95 °C and loaded onto 12% SDS-PAGE gel, and transferred to PVDF membrane. After incubation with anti-β-Actin antibody (nb100-74340, Novus), anti-TGF-β1 antibody (Abcam, USA), anti-TGFβR1 antibody, anti-Smad2 antibody, anti-Smad3 antibody, or anti-Smad4 antibody (Cell Signaling, USA) at 4 °C overnight, the blots were incubated with HRP-conjugated secondary antibody (1:5000). Signals were visualized using ECL substrates (PerkinElmer, USA) and recorded by UVP BioSpectrum imaging system. The semi-quantitative analyses of the protein levels were performed by Launch VisionWorks LS. β-Actin was used as an internal control for normalization purpose.
Anti smad4 antibody
Manufactured by Cell Signaling Technology
Sourced in United States
The Anti-Smad4 antibody is a laboratory reagent used to detect the Smad4 protein, which plays a crucial role in the transforming growth factor-beta (TGF-β) signaling pathway. This antibody can be used in various analytical techniques, such as Western blotting, immunoprecipitation, and immunohistochemistry, to study the expression and localization of Smad4 in biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Chip assay kit, by Merck Group (2 mentions)
Anti β actin antibody, by Novus Biologicals (1 mentions)
Anti smad3 antibody, by Cell Signaling Technology (1 mentions)
Ecl substrate, by PerkinElmer (1 mentions)
Anti smad2 antibody, by Cell Signaling Technology (1 mentions)
Anti tgf β1 antibody, by Abcam (1 mentions)
Normal rabbit igg, by Cell Signaling Technology (1 mentions)
Agilent dna 1000 chip, by Agilent Technologies (1 mentions)
Qubit hs dna kit, by Thermo Fisher Scientific (1 mentions)
Qubit dna hs kit, by Agilent Technologies (1 mentions)
Simplechip, by Cell Signaling Technology (1 mentions)
Truseq chip library preparation kit, by Illumina (1 mentions)
Anti cd31 antibody, by Abcam (1 mentions)
Protein assay reagent, by Bio-Rad (1 mentions)
Irdye 680lt goat anti mouse lgg, by LI COR (1 mentions)
Irdye 680lt goat anti rabbit lgg, by LI COR (1 mentions)
Odyssey blocking buffer, by LI COR (1 mentions)
Nitrocellulose membrane, by Bio-Rad (1 mentions)
Enzymatic shearing kit, by Active Motif (1 mentions)
Protein g magnetic beads, by Cell Signaling Technology (1 mentions)
10 protocols using anti smad4 antibody
1
Western Blot Analysis of TGF-β Signaling
2
Characterizing SMAD4 binding to LINP1 promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were carried out with chromatins prepared as reported previously (Takahashi et al., 2000) from A549 cells. DNA-protein complexes were immunoprecipitated using anti-SMAD4 antibody (#38454, Cell Signaling Technology) or Normal Rabbit IgG (#2729, Cell Signaling Technology). The specific primers for the SMAD4 binding of LINP1 promoter are as follows:
-1924F: 5'- CATTCCCACCAATAAGG -3'
-1727R: 5'- TAAGCCCAACAATCACT -3'
+654F: 5'- GCTGGTTCCGTAGTTT -3'
+917R: 5'- CAAGAAATGGAGTGCC -3'
-1924F: 5'- CATTCCCACCAATAAGG -3'
-1727R: 5'- TAAGCCCAACAATCACT -3'
+654F: 5'- GCTGGTTCCGTAGTTT -3'
+917R: 5'- CAAGAAATGGAGTGCC -3'
3
Genome-Wide Mapping of SMAD4 Binding
4
Immunohistochemical Analysis of Ovarian Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ovarian cancer tissues were fixed in 4% formalin, embedded in paraffin, and then sliced into 20‐μm‐thick sections. The paraffin sections were dried for 45 min at 60 °C, deparaffinized with xylene, and rehydrated by wash with a graded concentration of alcohol (100–80%). The tissue sections were blocked with 10% BSA for 2 h at room temperature and then incubated with specific primary antibodies overnight at 4 °C. On the next day, slices were washed with PBS three times followed by incubation with specific secondary antibodies for 2 h at room temperature. Signals were analyzed with HRP IHC detection kit (Abcam) according to the manufacturer's instructions. Primary antibodies used in this study are as follows: rabbit polyclonal anti‐Smad4 antibody (1 : 500; Cell Signaling, Boston, MA, USA) and rabbit polyclonal anti‐CD31 antibody (1 : 500; Abcam, Burlington, MA, USA).
5
ChIP Analysis of Smad4 Binding to TPM2 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A chromatin immunoprecipitation (ChIP) assay was performed according to the protocol for the Millipore ChIP assay kit (catalog no. 17-10085). For plasmid DNA transfection, 0.7 μl plasmid DNA complex (1.5 μg/μl) was injected into the rat CA1 area bilaterally 48 h before sacrifice. The CA1 tissue was washed using 1X ice cold PBS and fixed with 1% formaldehyde by adding formaldehyde to the 1X ice cold PBS for 10 min. After adding glycine to quench the unreacted formaldehyde, the tissue was homogenized and resuspended in cell lysis buffer plus protease inhibitor cocktail II, then changed to nuclear lysis buffer plus protease inhibitor cocktail II for sonication. The chromatin was immunoprecipitated using anti-Smad4 antibody (1:3000, catalog no. 9515, Cell Signaling). DNA purified from the immunoprecipitated samples was subjected to the PCR reaction using the following primers for the TPM2 promoter. The forward primer is 5'-CAGCCGCAGCTGCCGCTG-3' (nucleotides -432 to -415) and the reverse primer is 5'-ACAAGACCCTTGGGCCGG-3' (nucleotides -363 to -380). The PCR product was 70 bp in length and was separated by agarose gel electrophoresis.
6
Western Blot Analysis of Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Proteins were extracted from the transfected cells using a lysis buffer (Upstate Biotechnology, Lake Placid, NY, USA). The protein level was determined using protein assay reagents following the standard protocols (Bio-Rad Laboratories, Hercules, CA, USA). Briefly, 25 µg of total protein was loaded on 12% PAGE gel (Thermo Fisher Scientific) and transferred to a nitrocellulose membrane (Bio-Rad Laboratories). Following the transfer, the membranes were blocked with Odyssey® blocking buffer (LI-COR Biosciences, Lincoln, NE, USA), and then they were incubated in primary antibodies buffer (primary antibodies, Odyssey Blocking Buffer, 0.1% Tween® 20) overnight at 4°C. Two primary antibodies, anti-phosphatase-and-tensin homolog (PTEN) antibody and anti-SMAD4 antibody, were purchased from Cell Signaling Technology Inc. (Beverly, MA, USA). The following day, the membranes were washed four times for 5 minutes in Tris-buffered saline and Tween 20 prior to being incubated in the secondary antibodies IRDye® 680LT Goat anti-Mouse lgG or IRDye 680LT Goat anti-Rabbit lgG (LI-COR) plus Odyssey blocking buffer and 0.1% Tween 20 at 1:20,000 dilution for 1 hour. Finally, the membranes were visualized on an Odyssey CLx imaging system, model:Ody-3086 (LI-COR).
7
ChIP Assay for Transcription Factor Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ChIP assay was performed with using a ChIP-IT Express Enzymatic kit (Active Motif) as previously described [29 (link)]. Briefly, 1 × 107 cells were cross-linked with 1% formaldehyde for 10 min at room temperature and quenched by adding glycine. To harvest chromatin-DNA complexes, the cell lysate was treated with an enzymatic shearing kit (Active Motif), according to the manufacturer's specifications. For immunoprecipitation, 120 μg of chromatin-DNA complexes were incubated with Protein G magnetic beads linked to anti-SMAD4 antibody (10 μg, Cell Signaling Technology, Danvers, Massachusetts, USA), or anti-IgG antibody (10 μg, Active Motif). Eluates were used as templates for PCR. Equal amounts of anti-IgG or pre-immune chromatin-DNA complex were used as controls. The primer sets used for PCR amplification were: SNAI1: 5′-GCTGTCACACCCGGCACCAAG-3′ and 5′-GGCGGCTTGAAATGCCACGG-3′, SNAI2: 5′-ATGCGTGTGAAGTGCTTAGCATAGT-3′ and 5′-CACTCAGTGCCCAACAGTGTGT-3′, ZEB1: 5′-TTTCGGGAAGTTAAAATGTTTG-3′ and 5′-ATCCTGCTTCATCTGCCTGA-3′, ZEB2: 5′-TACGCCTGCGCTGTGACCTA-3′ and 5′-ACTCACTGGACCCGCCTCAG-3′, and TWIST: 5′-AGTCTCCTCCGACCGCTTCCTG-3′ and 5′-CTCCGTGCAGGCGGAAAGTTTGG-3′.
8
ChIP and miRNA Analysis in Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP analysis was conducted following the manufacturer’s instructions for the SimpleChIP Plus Sonication Chromatin IP Kit (#56383; Cell Signaling Technology, Danvers, MA). The reagent includes anti‐SMAD4 antibody (#38454; Cell Signaling Technology), rabbit IgG (#2729S; Cell Signaling Technology), and ChIP‐Grade Protein G Magnetic Beads (#9006; Cell Signaling Technology). The PCR primer for ChIP assays was forward primer (5′‐GTTTAGGGCCAGGGAGCTG‐3′) and reverse primer (5′‐AGCCTTGACGGTTTGACCTTC‐3′).
Total RNA was extracted using TRIzol reagent (#9109; Takara, Kyoto, Japan). miRNAs were reverse‐transcribed into the cDNA using specific Bulge‐Loop RT primers and RT reagent kit (#K1622; Thermo Fisher Scientific, Waltham, MA). The relative miRNA levels were normalized to small nuclear RNA U6. All of the Bulge‐Loop RT primers and U6 were purchased from RiboBio Co., Ltd. (Guangzhou, China).
Total RNA was extracted using TRIzol reagent (#9109; Takara, Kyoto, Japan). miRNAs were reverse‐transcribed into the cDNA using specific Bulge‐Loop RT primers and RT reagent kit (#K1622; Thermo Fisher Scientific, Waltham, MA). The relative miRNA levels were normalized to small nuclear RNA U6. All of the Bulge‐Loop RT primers and U6 were purchased from RiboBio Co., Ltd. (Guangzhou, China).
9
ChIP-PCR Analysis of Smad4 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ChIP Assay Kit was purchased from Millipore (Boston, MA, USA). In brief, the nuclei were extracted from C2C12 cells cultured in 10-cm dish with or without TGF-β stimuli and then sonicated into fragments. Precleared chromatin was incubated with anti-Smad4 antibody and control immunoglobulin G (IgG) antibody (both from Cell Signaling Technology). After the removal of the protein and RNA, the precipitated DNA was purified and subjected to PCR. The sequences of primers specific for the Smad binding element (SBE) in miR-24 and miR-122 promoters were listed in Table S3 . PCR-amplified products were then resolved by 1.5% agarose gel electrophoresis.
10
ChIP Assay for Th17 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ChIP assay was conducted according to the protocol provided by Pierce Magnetic ChIP Kit (Thermo Fisher Scientific). Pathogenic Th17 cells were polarized from mouse naive CD4+ T cells as described above, and 4 × 106 Th17 cells were cross-linked with 1% formaldehyde and sonicated to shear genomic DNA. The sample was subjected to immunoprecipitation (IP) overnight at 4 °C with the anti-Smad4 antibody (10 µg) (Cell Signaling), anti-RNA Polymerase II antibody (Thermo Fisher Scientific) as the positive control for its binding to Gapdh promoter, and normal rabbit IgG (Thermo Fisher Scientific) as the negative control in the IP step. The protein-chromatin complexes were then purified by magnetic beads (Thermo Fisher Scientific). DNA in the IP was quantified by qPCR analysis. The primer sequences used in ChIP qPCR were: Rorc: 5′-GGGGAGAGCTTTGTGCAGAT-3′ and 5′-AGTAGGGTAGCCCAGGACAG-3′, and Gapdh: 5′-CATCACTGCCACCCAGAAGACTG-3′ and 5′-ATGCCAGTGAGCTTCCCGTTCAG-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!