The largest database of trusted experimental protocols

12 protocols using nc sirna sc 37007

1

Plasmid Transfection and Screening

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids pCMV6‐ddk‐myc and pCMV6‐ddk‐myc‐BAIAP2L1 were purchased from Origene. RPL3‐ (sc‐152,909) and NC‐siRNA (sc‐37,007) were purchased from Santa Cruz Biotechnology. Control and BAIAP2L1 sgRNA, BAIAP2L1‐ΔI‐BAR, BAIAP2L1‐ΔSH3, BAIAP2L1‐ΔF actin‐binding, RPL3‐FL, RPL3‐Δ1‐43, and RPL3‐Δ203‐287 splicing mutant plasmids were purchased from GenePharma Co. Ltd. BAIAP2L1‐sgRNA (CGCCAAGGTAGCCCTGAACGTGG) and its control sgRNA (GCACTACCAGAGCTAACTTCA) were made using a lentiviral vector (pLenti‐U6‐spgRNAv2.0‐CMV‐Puro‐P2A‐3xFLAG‐spCas9‐WPRE; GenePharma). Transfection was carried out using Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer's instructions. Puromycin (ST551; Beyotime) was used to screen stably transfected cells.
+ Open protocol
+ Expand
2

Plasmid Transfection Optimization

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids pCMV6-ddk-myc and pCMV6-ddk-myc-ZNF452 were purchased from Origene (Rockville, MD, USA).ZNF452-siRNA (sc-95338) and NC-siRNA (sc-37007) was purchased from Santa Cruz Biotechnology. Transfection was carried out using the Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer's instructions.
+ Open protocol
+ Expand
3

TMEM88 Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pCMV6-DDK-Myc empty vector and the pCMV6-DDK-Myc-TMEM88 CRA-a (TMEM88) vector were purchased from OriGene (Rockville, MD, USA), the TMEM88-ΔC vector was constructed by Takara Bio Inc. (Dalian, China), and the Super8 × TOPFlash, Super8 × FOPFlash, and pRL-TK vectors were purchased from Addgene (Cambridge, MA, USA). The TMEM88-siRNA (sc-93891) and NC-siRNA (sc-37007) were purchased from Santa Cruz Biotechnology. Transfection was carried out using a Lipofectamine 2000 kit (Invitrogen), according to the manufacturer's instructions.
+ Open protocol
+ Expand
4

Plasmid Transfection and Gene Silencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids pCMV6-ddk-myc and pCMV6-ddk-myc-Lasp1 were purchased from Origene (RC219975, Rockville, MD, USA). Lasp1-siRNA (sc-105607) and NC-siRNA (sc-37007) were purchased from Santa Cruz Biotechnology. Transfection was carried out using the Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer’s instructions.
+ Open protocol
+ Expand
5

Plasmid Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids pCMV6-ddk-myc and pCMV6-ddk-myc-ZNF259 were purchased from Origene (RC205721, Rockville, MD, USA). ZNF259-siRNA (sc-35282) and NC-siRNA (sc-37007) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Transfection was carried out using the Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer’s instructions.
+ Open protocol
+ Expand
6

Transfection of BHLHE40 and BHLHE41 in MCF-7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids pCMV and pCMV‐Myc‐SP1 were purchased from Sino Biological (HG12024‐NM). Plasmid pcDNA3.1, pcDNA3.1‐BHLHE40 and pcDNA3.1‐BHLHE41 were generous gifts from Prof. Kijima, and the efficiency was demonstrated in a previous study.16 The plasmid pcDNA3.1‐BHLHE40 was inserted with N‐His‐Flag‐tag, and the plasmid pcDNA3.1‐BHLHE41 was inserted with N‐His‐Myc‐tag as described previously.25 The MCF‐7 cells were seeded at a density of 1 × 105 cells per well (35 mm). After 24 hours, the cells were transfected with BHLHE40 or BHLHE41 using Lipofectamine LTX (Invitrogen). The cells were incubated for 24 hours following transfection and subjected to various analyses. NC‐siRNA (sc‐37007) was purchased from Santa Cruz Biotechnology. The sequences for the sense and antisense of three kinds of BHLHE41 siRNA are shown in Table 2. For the siRNA transfection experiments, MCF‐7 and MDA‐MB‐231 cells were seeded at 5 × 104 cells per 35‐mm well. After 24 hours, the siRNA was transfected into the cells using Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer's instructions. The transfected cells were incubated for another 48 hours and subjected to various analyses. The total amount of siRNA was adjusted with the control siRNA.
+ Open protocol
+ Expand
7

Overexpression of TMEM17 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids pCMV6-ddk-myc and pCMV6-ddk-myc-TMEM17 were purchased from OriGene (Rockville, MD, USA). TMEM17-siRNA (sc-94962) and NC-siRNA (sc-37007) were purchased from Santa Cruz Biotechnology Inc. Transfection was performed using Lipofectamine 3000 reagent (Thermo Fisher Scientific) in accordance with the manufacturer’s instructions.
+ Open protocol
+ Expand
8

Overexpression and knockdown of C14orf159

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids pCMV6-ddk-myc-C14orf159 (RC223847) and pCMV6-ddk-myc were bought from Origene (Rockville, MD, USA). C14orf159-siRNA (sc-92378) and NC-siRNA (sc-37007) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Lipofectamine 3000 reagent (Thermo Fisher Scientific, Waltham, MA, USA) was used to transfect as we described previously.7 (link)
+ Open protocol
+ Expand
9

SETD5 Overexpression and Silencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
We bought the pCMV6-ddk-myc-SETD5 and pCMV6-ddk-myc plasmids from Origene (RC240118, Rockville, MD, USA). SETD5-siRNA (sc-78478) and NC-siRNA (sc-37007) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Transfection was carried out using the Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.
+ Open protocol
+ Expand
10

Knockdown of USP7 in BMDMs

Check if the same lab product or an alternative is used in the 5 most similar protocols
BMDMs were seeded in 6-well-plates (2×105 cells per well). After 24 h, they were transfected with either small interfering RNA (siRNA) against USP7 or negative control (NC) siRNA using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA). Cells were harvested after 48 h and processed for western blotting and flow cytometry. USP7 siRNA (sc-77373) and NC siRNA (sc-37007) were purchased from Santa Cruz Biotechnology, Inc.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!