The largest database of trusted experimental protocols

Nana drop 2000

Manufactured by Thermo Fisher Scientific
Sourced in United States

The NanoDrop 2000 is a spectrophotometer designed for the measurement of nucleic acid and protein concentrations. It utilizes a patented sample retention technology to enable sample measurement in a small volume of 0.5 to 2 microliters, without the need for cuvettes or other sample containment devices.

Automatically generated - may contain errors

3 protocols using nana drop 2000

1

Quantification of Gene Expression in Ovary and Skeletal Muscle

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from ovary or skeletal muscle tissues using a RNApure total RNA isolation kit (Bio Teke, Beijing, China). The concentration of RNA was detected on an ultraviolet spectrophotometer (Nana Drop 2000, Thermo Scientific, USA). Subsequently, cDNA was synthesized using M-MLV Reverse Transcriptase (Takara, Japan). Real time PCR was carried out using Taq HS Perfect Mix (Takara) and SYBR Green (Bio Teke) on an Exicycler™ 96 Real-Time Quantitative Thermal Block (BIONEER, Korea). The primer sequences are presented in Table 1. The mRNA expression level was calculated by 2-△△CT method.

Oligonucleotide primer sets for real-time PCR

NameSequence (5′¬3′)Length
CYP17 FTGGAGGTGATAAAGGGTT18
CYP17 RCGTCAGGCTGGAGATAGA18
CYP19 FGCCTGTCGTGGACTTGGT18
CYP19 RTAAATTCATTGGGCTTGG18
PPARγ FTACCACGGTTGATTTCTC18
PPARγ RAATAATAAGGCGGGGACG18
PGC-1α FGAACAAGACTATTGAGCGAACC22
PGC-1α RGAGTGGCTGCCTTGGGTA18
β-actin FCCACTGCCGCATCCTCTT18
β-actin RGGTCTTTACGGATGTCAACG20
+ Open protocol
+ Expand
2

Transcriptional Analysis of Babesia bigemina

Check if the same lab product or an alternative is used in the 5 most similar protocols

B. bigemina was cultured under ambient oxygen (approx. 20% O2 and 5% CO2) or low oxygen (3% O2, 5% CO2, and 92% N2) conditions. Samples were collected until parasitemia reached 5%. RNA was extracted by using Trizol (Invitrogen, Waltham, MA, USA). RNA purity and concentration were monitored by using a Nanadrop 2000 (Thermofisher, Waltham, MA, USA). Five hundred nanograms of RNA was used for cDNA synthesis by using the SuperScript™ First-Strand kit (Invitrogen, Waltham, MA, USA).
Three pairs of primers were designed based on the sequence of BbigLDH and 18S rRNA by using RT-PCR design wizard in Clone manager version 8, respectively. All the primers were subjected to quantitative polymerase chain reaction (qPCR); the pairs showed stable results, and the melt curve was selected for further study. The LDH transcription level was determined by qPCR, and the B. bigemina 18S rRNA gene was used as a reference. The primers for qPCR are listed in Table 1.
+ Open protocol
+ Expand
3

Quantitative analysis of MYCN expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA was isolated using RNAsimple Total RNA Kit (TIANGEN DP419), and the RNA concentration was measured using NanaDrop 2000 (Thermo Scientific). The integrity of RNA was tested by running AGE (agarose gel electrophoresis). Reverse transcription of RNA utilized PrimeScript RT Master Mix (TAKARA RR036A), subsequently followed by real-time PCR using SYBR®Premix Ex Taq (TAKARA RR420A). Relative abundance of mRNA transcript for the selected genes was calculated using the ΔΔCt approximation relative to housekeeping gene GAPDH. The real-time PCR primers were MYCN-F 5′-ACAGTGAGCGTCGCAGAAAC-3′, MYCN-R 5′-AGCAAGTCCGAGCGTGTTC-3′, GAPDH-F 5′-AATCCCATCACCATCTTCC-3′, and GAPDH-R 5′-CATCACGCCACAGTTTCC-3′.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!