Fetal bovine serum (fbs)

A172, LN229, U87MG, LN18 and T98G cell lines (ATCC, Rockville, MD, USA) were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (Aurogene) in a humidified atmosphere containing 5% CO₂ at 37° C. Transfections were performed by Lipofectamine 3000 reagent (Invitrogen) using plasmid DNA or DsiRNA H19 (HSC.RNAI.NR_002196.12, which consists of 3 predesigned DsiRNAs for the same target, H19, a negative control, NC1, and positive controls for transfection, TYE, all from Integrated DNA Technologies, IDT) in Opti-MEM I (Invitrogen), as recommended by the manufacturer.
Plasmids used: pcDNA3.1 empty vector (Clontech); pEGFP-C1 empty vector (Clontech); pCMV-Script H19 (BamH1/EcoRI) kindly provided by Dr. Imad Matouk, the Hebrew University of Jerusalem, Israel; pCMV-Script H19 mut (BamH1/EcoRI) was generated by mutating the miR-675 sequence within H19 (3 nucleotides in the seed sequence of the miR and 3 nucleotides outside the seed). The primers used for mutagenesis were the following:
For: 5′ tgtacaggcgaggtccgacagtggacttgg 3′
Rev: 5′ tgtcggacctcgcctgtacagaccctgggc 3′
p-Myc-EZH2 vector was kindly provided by Dr.ssa Daniela Palacios, Fondazione Santa Lucia IRCCS, Roma.
The generation of stably transfected A172 cell lines was obtained by growing cells in medium containing the selective agent, G418, 1 mg/ml for three weeks.

If not otherwise specified, all the substances, among which were 3-(4,5 dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT; CAS number: 298-93-1; purity ≥ 98%), tert-butyl hydroperoxide (tBOOH; 70% wt in H₂O), 2,7-dichlorofluorescein diacetate (DCFH-DA; CAS number: 4091-99-0; purity ≥ 97%), anti-NF-E2 primary antibody (ABE413), montelukast (MNT; CAS number: 151767-02-1; purity ≤ 100%), and the solvent dimethyl sulfoxide (DMSO; CAS number: 67-68-5; for molecular biology), were purchased from Merck (Darmstadt, Germany). All the materials used for cell cultures, including the RPMI 1640 medium, fetal bovine serum, cofactors, and antibiotics, were provided by Aurogene (Rome, Italy).

The chemicals β-caryophyllene (≥98.5% purity), β-caryophyllene oxide (95% purity), and verapamil hydrochloride (≥98.0% purity) were purchased from Merck Life Science S.r.l. (Milan, Italy), while sorafenib tosylate (≥99.0% purity) and MK571 (≥96.0% purity) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Dulbecco’s Modified Eagle’s medium (DMEM), Roswell Park Memorial Institute (RPMI) 1640 culture medium, fetal bovine serum, buffer, and cofactors were from Aurogene S.r.l. (Rome, Italy). EtOH (100% v/v) was used to dissolve β-caryophyllene and β-caryophyllene oxide, while DMSO (100% v/v) was used for sorafenib tosylate, verapamil hydrochloride, and MK571. Solvents were used up to 1% v/v nontoxic concentration.

The synthesis of the ligands and complexes was performed according to the protocol described by Sgarbossa and co-workers [18 (link)]. Complexes and ligands were dissolved in DMSO as a 10 mM stock solution and stored at room temperature. SB202190, AZD6244, and SP600125 were purchased from Selleck Chemical (Houston, TX); they were dissolved in DMSO as a 20 mM stock solution and stored at −20 °C. Vanadyl sulfate (VOSO₄), 4’,6-diamidino-2-phenylindole (DAPI), Mowiol^® 4-88, RNase, propidium iodide, EDTA, protease inhibitor cocktails, and monoclonal anti-β-actin antibody were purchased from Sigma-Aldrich (St. Louis, MO). VOSO₄ was freshly dissolved in medium. DMEM, DMEM-F12, RPMI 1640, and fetal bovine serum (FBS) were purchased from Aurogene (Rome, IT). EGF, insulin, hydrocortisone, penicillin/streptomycin antibiotic mixture, amphotericin B, and glutamine were purchased from Sigma-Aldrich (Milan, IT).

A murine monocyte/macrophage J774 cell
line was obtained from the American Type Culture Collection (ATTC
TIB 67). The cell line was grown in adhesion in Dulbecco’s
modified Eagle’s medium (DMEM) supplemented with glutamine
(2 mM, Aurogene Rome, Italy), Hepes (25 mM, Aurogene Rome, Italy),
penicillin (100 U/mL, Aurogene Rome, Italy), streptomycin (100 μg/mL,
Aurogene Rome, Italy), fetal bovine serum (FBS, 10%, Aurogene Rome,
Italy), and sodium pyruvate (1.2%, Aurogene Rome, Italy) (DMEM completed).
The cells were plated at a density of 1 × 10⁶ cells
in 75 cm² culture flasks and maintained at 37 °C under
5% CO₂ in a humidified incubator until 90% confluence.
The culture medium was changed every 2 days. Before a confluent monolayer
appeared, the subculturing cell process was carried out.