The largest database of trusted experimental protocols

Kapa sybr green supermix pcr kit

Manufactured by Agilent Technologies
Sourced in United States

The KAPA SYBR Green Supermix PCR kit is a reagent kit designed for real-time PCR applications. It contains a proprietary buffer system, KAPA SYBR Green I dye, and a highly processive and thermostable DNA polymerase. The kit is optimized for sensitive and reproducible quantification of DNA targets.

Automatically generated - may contain errors

2 protocols using kapa sybr green supermix pcr kit

1

Total RNA Extraction and Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from cells was extracted using Cell Culture and Tissue Total RNA Extraction and Preparation Mini kit (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The quantity and quality of RNA were confirmed using a NanoDrop 1000. The primers were designed using Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA, USA) and synthesized by Generay Biotech Co., Ltd. (Table IV). RT-qPCR was performed using the KAPA SYBR Green Supermix PCR kit with the AriaMx Real-Time PCR System (both Agilent Technologies, Inc., Santa Clara, CA, USA). RT was performed at 50°C for 30 min. qPCR conditions: Denaturing at 95°C, 10 min, then 40 cycles of denaturing at 95°C for 15 sec, annealing at 60°C for 1 min, and elongation at 95°C for 15 sec and 60°C for 15 sec. The relative expression levels among the different genes were determined using the 2−ΔΔCq method (14 (link)).
+ Open protocol
+ Expand
2

RNA Extraction and RT-qPCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells using TRIzol reagent, and the purity of extracted RNA was confirmed using a NanoDrop 1000. The primers were designed using Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA, USA) and synthesized by Generay Biotech Co., Ltd. RT–qPCR was performed using the KAPA SYBR Green Supermix PCR kit with the AriaMx Real-Time PCR System (both from Agilent Technologies, Inc. Santa Clara, CA, USA). The 2-ΔΔCT method was used for semiquantitative analysis [14 (link)]. Table 1 shows the primer and siRNA information.

Primer and siRNA information

PrimerSequence (5′-3′)
endoglin-siRNA senseGGCCAGCAUUGUCUCACUUTT
endoglin-siRNA antisenseAAGUGAGACAAUGCUGGCCTT
Homo-endoglin-FGATCCAGACAAAGTGTGCCG
Homo-endoglin-RAGGATATTGACCACCGCCTC
Homo-SMAD2-FCCAGGTCTCTTGATGGTCGT
Homo-SMAD2-RTTAGGATCTCGGTGTGTCGG
Homo-SMAD3-FATAACTTGGACCTGCAGCCA
Homo-SMAD3-RACATTGGAGAGCAGCCCTAG
Homo-SMAD4-FGCTGCTGGAATTGGTGTTGA
Homo-SMAD4-RCTTCGTCTAGGAGCTGGAGG
Homo-BCL2-FTTCTTTGAGTTCGGTGGGGT
Homo-BCL2-RCTTCAGAGACAGCCAGGAGA
Homo-SERPINE1-FACTGGAAAGGCAACATGACC
Homo-SERPINE1-RTGACAGCTGTGGATGAGGAG
Homo-CCL2-FTCTGTGCCTGCTGCTCATAG
Homo-CCL2-RCAGATCTCCTTGGCCACAAT
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!