Total foxo3a

The gastrocnemius muscle was homogenized in an extraction buffer containing protease and phosphatase inhibitors (Roche Diagnostics GmbH, Sandhoferstrasse, Mannheim, Germany). After centrifugation, the supernatant was subjected to protein quantification determined by the Bradford assay (Bio-Rad, Hercules, CA, USA) using an albumin standard curve. Samples were diluted in Laemmli’s buffer and submitted to SDS polyacrylamide gel electrophoresis (Sodium dodecyl sulfate (SDS)-PAGE) (25 (link)), transferred to a Polyvinylidene fluoride (PVDF) membrane, and incubated with primary antibodies against Akt (ref. 4685), Akt Ser473 (ref. 4058), total FoxO3a (ref. 9467), FoxO3a Ser253 (ref. 9466) (Cell Signaling Technology Danvers, MA, USA), or GAPDH (Santa Cruz Biotechnology, Santa Cruz, CA, USA, ref. SC 25778). They were then incubated with a peroxidase-conjugated anti-IgG antibody and after incubated with the peroxidase substrate (ECL Clarity TM, Bio-Rad, Hercules, CA, USA). GAPDH expression was used as an internal control. Images were obtained using the Amersham Imager 600 equipment (GE Healthcare, Buckinghamshire, UK) and quantified by optical densitometry using Image J software (National Institute of Health, Bethesda, MD, USA).

Cells were lysed in cell lysis buffer (20 mM Tris, pH 7.5, 135 mM NaCl, 5% [v/v] glycerol, 50 mM NaF, 0.1% [v/v] Triton X-100, plus protease inhibitors), centrifuged and protein quantified using Bradford reagent (Sigma-Aldrich). Samples were made up in NuPAGE LDS sample buffer (Life Technologies). Western blotting was performed as previously described [28 (link)]. Blots shown are representative of 3 independent experiments. Anti-β-actin (#4967), phospho-TSC2 S1387 (#5584), total TSC2 (#3990), IRE1α (3294S), phospho-S6K1 T389 (#9205), total S6K1 (#9202), phospho-rpS6 S235/236 (#2211), total rpS6 (#2217), phospho-4E-BP1 S65 (#9451), total 4E-BP1 (#9644), phospho-ACC S79 (#3661), total ACC (#3676), PARP (#9542), caspase 3 (#9662), ATF4 (#11815), phospho-FOXO3a (#9466S), total FOXO3a (#9467), phospho-PRAS40 T246 (#2997), total PRAS40 (#2691) and phospho-Bad S136 (#4366) antibodies were from Cell Signaling Technology (Danvers, MA, USA). GADD34 antibody (10449-1-AP) was from Proteintech (Manchester, UK).

Primary antibodies against p53, Phospho-Akt (S473), total-Akt, Phospho-FoxO3a (S253), total-FoxO3a, Phospho-ERK (Thr202/Tyr204), total-ERK, PUMA, Bax and cleaved Caspase3, β-actin were purchased from cell signaling; α-tubulin antibody was from Santa Cruz Technologies. Lipofectamine™ Reagent was purchased from Invitrogen. HRP-conjugated anti-rabbit and or anti-mouse secondary antibodies an ECL-plus kit were from GE Healthcare. 5-FU was purchased from APP Pharmaceuticals. Cisplatin and regofenib were purchased from Axon Medchem. Other chemicals were mainly from Sigma. The plasmid of expressing PUMA was kindly supplied by Jian Yu, Ph.D. [31 (link)]. The oligonucleotide for shFOXO3a was synthesized as 5′-CACCGACTCCGGGTCCAGCTCCACTTCAAGA GAGTGGAGCTGGACCCGGAGTTTT TTTG-3′.