N myc tagged pmx puro retroviral vector

NOTCH1–ROS1 and Trunc. NOTCH1–ROS1 constructs were synthesized as gateway compatible entry clones by GenScript. Full-length NOTCH1 and full-length ROS1 were purchased as gateway entry clones from GenScript and PlasmID/Dana-Farber/Harvard Cancer Center DNA Resource Core, respectively. Subcloning was conducted to integrate NOTCH1–ROS1, Trunc. NOTCH1–ROS1, NOTCH1, and ROS1 into Gateway-compatible N-MYC-tagged pMX-Puro Retroviral Vector (Cell Biolabs). NIH3T3 cells were transduced using a previously described infection protocol (Jain et al. 2017 (link)). Ba/F3 cells were transduced with virus generated from the Plat-E retroviral packaging cell line (Cell Biolabs). Prior to infection, cells were treated with 10 µg/mL polybrene. Virus was harvested at 48 h and filtered with a 0.45 µm syringe filter before addition. Upon viral infection and addition of 10 mM HEPES, cells were inoculated for 90 min and then incubated for 72 h. An amount of 2 µg/mL puromycin was then utilized to select stably transduced cells. All constructs were subcloned into gateway destination vectors with amino-terminal Myc and Flag tags Invitrogen). Expression of tagged proteins was detected using anti-Myc HRP Antibody (Invitrogen R951-25; 1:5000) and anti-Flag HRP antibody (Sigma-Aldrich A8592; 1:5000).

SRGAP3-RAF1 and QKI-RAF1 constructs were synthesized as Gateway-compatible entry clones. Full-length RAF1, QKI and SRGAP3 were purchased as gateway entry clones from PlasmID/Dana-Farber/Harvard Cancer Center DNA Resource Core. Subcloning was carried out to integrate SRGAP3-RAF1, QKI-RAF1, full-length QKI, RAF1 and SRGAP3 into Gateway-compatible N-MYC-tagged pMX-Puro Retroviral Vector (Cell Biolabs, San Diego, CA, USA). NIH3T3 and early-passage PMAs were transduced using infection protocol previously described.^{18 (link)} Gateway destination vectors with either an N-terminal MYC or FLAG tag (Invitrogen, Waltham, MA, USA) were generated for all constructs. Anti-MYC antibody (Invitrogen R951-25, 1:5000) and anti-FLAG antibody (Sigma A8592, 1:10 000 from Sigma-Aldrich, St Louis, MO, USA) were used to detect tagged proteins along with anti-CRAF antibody (Cell Signaling #9422 from Cell Signaling Technology, Danvers, MA, USA).
QKI-RAF1 dimerization mutants were generated by polymerase chain reaction-based site-directed mutagenesis of MYC- and FLAG-tagged constructs. RAF^R401H dimerization mutants^{35 (link), 36 (link)} in QKI-RAF1 were generated using primers: forward CGCAAAACACACCATGTGAACA and reverse CAGAACAGCCACCTCATTCCT. QKI^E48G dimerization mutants^{31 (link)} in QKI-RAF1 were generated using primers: forward CTGGACGAAGGAATTAGCAGAG and reverse CAGCCGCTCGAGGTGGTT.