Specimens of C. chinensis were collected from Zhanggou Village, Leshan City, Sichuan Province, China (29.51° N 103.42° E), in November 2021. Voucher specimens for sequencing were preserved under −80 °C at the Entomological Museum of China Agricultural University, Beijing, China. One male adult and one female adult of C. chinensis were pooled for total RNA extraction, using TRIzol Universal (Tiangen, Beijing, China). The concentration and purity of total RNA was detected by NanoDrop 2000 spectrophotometry (Thermo Fisher, Waltham, MA, USA), and the integrity was detected by the Agilent 2100 system (Agilent Technologies, Santa Clara, CA, USA). Total RNA was reverse transcribed into cDNA using the Clontech SMARTer PCR cDNA Synthesis Kit (Clontech Laboratories, Inc., Mountain View, CA, USA) with 3′ SMART CDS Primer II A (5′-AAGCAGTGGTATCAACGCAGAGTAC-T(30)-3′) and SMARTer II A Oligonucleotide (5′-AAGCAGTGGTATCAACGCAGAGTACATGGG-3′). The cDNA was amplified and the library with the insert size between 1 and 10 kb was constructed according to the PacBio Iso-Seq protocol after size selection. Finally, one SMRT cell was performed on the Pacbio Sequel platform with circular consensus sequencing (CCS) mode at Berry Genomics Company (Beijing, China).
Trizol universal
Manufactured by Tiangen Biotech
Sourced in China
TRIzol Universal is a reagent designed for the isolation and purification of total RNA from a variety of biological samples, including cells, tissues, and microorganisms. It is a monophasic solution containing phenol and guanidine isothiocyanate, which facilitates the lysis of cells and the subsequent separation of RNA from DNA and proteins.
Automatically generated - may contain errors
Lab products found in correlation
Clontech smarter pcr cdna synthesis kit, by Takara Bio (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (1 mentions)
Agilent 2100 system, by Agilent Technologies (1 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Smarter pcr cdna synthesis kit, by Takara Bio (1 mentions)
Pacbio sequel platform, by Pacific Biosciences (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
Primescript rt reagent kit, by Tiangen Biotech (1 mentions)
Rt2 profiler pcr array kit, by Qiagen (1 mentions)
Sybr green select master mix, by ABclonal (1 mentions)
Fastking rt kit, by Tiangen Biotech (1 mentions)
Tb green premix ex taq 2 kit, by Takara Bio (1 mentions)
Mircute plus mirna first strand cdna kit, by Tiangen Biotech (1 mentions)
Mircute mirna isolation kit, by Tiangen Biotech (1 mentions)
Primescript rt reagent kit with genomic dna eraser, by Takara Bio (1 mentions)
Mircute plus mirna qpcr kit sybr green, by Tiangen Biotech (1 mentions)
6 protocols using trizol universal
1
Sequencing of Camponotus chinensis
2
Transcriptome Analysis of Anadara gifuensis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 75 adult males of A. gifuensis from the laboratory in Kunming, Yunnan, China using TRIzol Universal (Tiangen, Beijing, China). The cDNA was synthesized using the Clontech SMARTer PCR cDNA Synthesis Kit (Clontech Laboratories, Inc, CA, USA) with 3′ SMART CDS Primer II A (5′-AAGCAGTGGTATCAACGCAGAGTAC-T(30)-3′) and SMARTer II A Oligonucleotide (5′-AAGCAGTGGTATCAACGCAGAGTACATGGG-3′). After size-selection, the cDNA was amplified and the library with the insert size between 0.5 and 6 kb was constructed according to the PacBio Iso-Seq protocol. Finally, one SMRT cell was performed on Pacbio Sequel platform with circular consensus sequencing (CCS) mode at GrandOmics Biosciences Company (Beijing, China).
3
Comprehensive RNA Sequencing from Adult Males
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 75 adult males using TRIzol Universal (Tiangen) (Rio et al., 2010 ). The NanoDrop spectrophotometer (Thermo Fisher) and Agilent 2100 Bioanalyzer were used to evaluate the quality of extracted RNA (OD260/280 = 2.0–2.2, OD260/230 = 1.8–2.1, 28 s:18 s ≥ 1.5, RIN ≥ 8). A total of 25.54 μg RNA was eluted with nuclease‐free water. The PacBio Iso‐Seq protocol was followed for library preparation: total RNA was reverse transcribed into cDNA using the Clontech SMARTer PCR cDNA Synthesis Kit. The cDNA was amplified for library construction with an insert size between 0.5 and 6 kb after size‐selection using the BluePippin (Sage). The sequencing was performed on one SMRT cell on the PacBio Sequel platform (Pacific Biosciences) in circular consensus sequencing (CCS) mode. Raw sequence data were filtered with the standard IsoSeq3 protocol before subsequent analysis, including circular consensus calling through ccs, clustering and polishing through isoseq 3 (https://github.com/ylipacbio/IsoSeq3 ).
4
RNA Extraction and Genetic Screening
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol Universal (TIANGEN, Beijing, China) according to the manufacturer's protocol. Absorbance was measured, and the purity of RNA was assessed using values of 280/260 and 260/230. cDNA was prepared using the PrimeScript RT reagent Kit (TIANGEN, Beijing, China) according to the manufacturer's instructions. Genetic screening was performed using an RT2 Profiler PCR Array kit (QIAGEN, Maryland, USA). The PCR array plate included 48 genes, including 40 target genes and 8 control genes. PCR amplification was performed under the following conditions: 40 cycles at 95°C for 15 s and 60°C for 60 s. GAPDH was used as an internal control. GAPDH forward primer (5′-3′): CAGGAGGCATTGCTGATGAT; GAPDH reverse primer (5′-3′): GAAGGCTGGGGCTCATTT; SPTLC2 forward primer (5'-3'): CAGATTGCTTGAGGCCAGGAAGTTC; SPTLC2 reverse primer (5'-3'): AGTGGTGTGATCTTGCTCATTGC.
5
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol Universal (TIANGEN, China) was used to extract total RNA from Marc-145 cells, which was subsequently reverse-transcribed into cDNA using a FastKing RT Kit (TIANGEN, China) following the manufacturer’s guidelines. SYBR Green Select Master Mix (ABclonal, China) was used for qPCR analysis on a Real-Time PCR Detection System (TIAN LONG, China). Relative expression levels of target genes were adjusted using β-actin as the internal standard and the 2−ΔΔCT method. All qPCR primers are listed in Table 3 .
| Primer name | Sequence (5′-3′) |
|---|---|
| H2BE-qF | TCCAAGAAAGCCGTCACCAA |
| H2BE-qR | GACCTGCTTCAGCACCTTGT |
| PEDV-qF | AGATCGCCAGTTTAGCACCA |
| PEDV-qR | GGCAAACCCACATCATCGT |
| IFN-β-qF | ACGGCTCTTTCCATGAGCTAC |
| IFN-β-qR | GTCAATGCAGCGTCCTCCTT |
| ISG15-qF | CACCGTGTTCATGAATCTGC |
| ISG15-qR | CTTTATTTCCGGCCCTTGAT |
| TET1-qF | GATGACAGAGGTTCTTGCACAT |
| TET1-qR | AGGTTGCACGGTCTCAGTGT |
| IRX1-qF | GGAATGTGGGAGGAATTAAGAC |
| IRX1-qR | GCATTTACCGAACCCGATA |
| LC3-qF | CATCCAACCAAAATCCCG |
| LC3-qR | GTGGCCGTTCACCAACAG |
| β-Actin-qF | CTTAGTTGCGTTACACCCTTTC |
| β-Actin-qR | TGTCACCTTCACCGTTCCA |
6
Quantification of mRNA and miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA and miRNAs were extracted using the TRIzol Universal and miRcute miRNA isolation kit, respectively (Tiangen, China). RNA was reverse transcribed into cDNA using the PrimeScript RT reagent kit with genomic DNA Eraser (Takara, China). RT-qPCR was performed using the TB GreenTM Premix Ex Taq II kit (Takara). For miRNA quanti cation, reverse transcription and qPCR were performed using the miRcute Plus miRNA First-Strand cDNA Kit and miRcute Plus miRNA qPCR Kit (SYBR Green), respectively (Tiangen) (Tiangen). RT-qPCR reactions were performed using a PCRmax Eco 48 real-time PCR machine (PCRmax, UK). The relative mRNA and miRNA expression levels were calculated using this method. Theactin gene was used as a housekeeping gene to normalise the expression of protein-coding genes. The sequences of the primers used for qPCR are shown in Table S3 in the Supplementary Materials.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!