Total RNA was extracted by using TRIzol reagent (Invitrogen). 1 μg RNA was reverse transcribed to cDNA using Reverse Transcription Master Kit (Takara) according to the manufacturer’s instructions. For quantitative PCR analysis, aliquots of cDNA were amplified using TB Green Premix Ex Taq II (Takara) and ViiATM7/QuantStudio 7 Flex Real Time PCR System (Applied Biosystems). GAPDH was used as an internal control. All reactions were performed in triplicate. The sequences of primers used are listed in the key resources table .
Reverse transcription master kit
Manufactured by Takara Bio
Sourced in Japan
The Reverse Transcription Master Kit is a laboratory instrument designed for the reverse transcription of RNA into complementary DNA (cDNA). It provides the necessary reagents and protocols to convert RNA into cDNA, which can then be used for various downstream applications, such as gene expression analysis, PCR, and sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Sybr green supermix, by Bio-Rad (2 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Cfx real time pcr system, by Bio-Rad (2 mentions)
Viiatm7 quantstudio 7 flex real time pcr system, by Thermo Fisher Scientific (1 mentions)
Tb green premix ex taq 2, by Takara Bio (1 mentions)
Power sybr green pcr master mix, by Takara Bio (1 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol, by Beyotime (1 mentions)
5 protocols using reverse transcription master kit
1
RNA Extraction and qPCR Analysis
2
Extraction and Quantification of Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen, Thermo Fisher Scientific), followed by quality and quantity measurements using a NanoDrop ONE (Thermo Fisher Scientific). Total RNA (1 mg) was reverse transcribed to cDNA using the Reverse Transcription Master Kit (Takara) according to the manufacturer’s instructions. RT-qPCR analysis was performed with SYBR green (SYBR Green Supermix; Bio-Rad) in a Bio-Rad CFX Real-Time PCR System. The ACTB gene was used as an internal control. The samples were run in technical triplicates.
3
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by using TRIzol reagent (Invitrogen). Five-hundred nanograms of RNA was reverse transcribed to cDNA using Reverse Transcription Master Kit (TAKARA) according to the manufacturer’s instructions. For quantitative PCR analysis, aliquots of cDNA were amplified using Power SYBR Green PCR Master Mix (TAKARA) and ViiA7 Real-Time PCR System (Applied Biosystems). GAPDH was used as an internal control. All reactions were performed in triplicate. The PCR primers are listed in Supplementary Table 5 .
4
Quantifying gene expression using qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol (Beyotime, China) was used to isolate total RNA. Then, the total RNA was transcribed to cDNA by reverse transcription master kit (Takara, Japan). Afterwards, the qPCR was performed with the application of qPCR kit (Takara, Japan). The thermal cycling was as follows: 1 cycle, 95°C for 30 s (s); 40 cycles, 95°C for 5 s and 61°C for 10 s. The primers (5’-> 3’) were as follows: PLK4, forward GCCTTATCACCTCCTCCTTCTG, reverse TGTAGTTGTAAGACCAAGTCCTTCA; GAPDH, forward GAGTCCACTGGCGTCTTCAC, reverse ATCTTG AGGCTGTTGTCATACTTCT. The data were calculated by 2−ΔΔCt method.
5
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen) was used to extract the total cellular RNA. A 1 μg amount of total RNA was reverse transcribed to cDNA. The reverse transcription master kit (Takara, Kusatsu City, Japan) was used to synthesize the cDNA from the RNA. SYBR green (SYBR Green Supermix, Bio-Rad, Hercules, CA, USA) was used to perform the RT-qPCR analysis in a Bio-Rad CFX Real-Time PCR System (Bio-Rad). Samples were run in technical triplicates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!