Ampure xp nucleic acid purification kit

After following the manufacturer’s instructions, the genomic DNA extraction was completed, and the extracted genomic DNA was detected using 1% agarose gel electrophoresis. In PCR amplification, the primers (5′-ACTCCTACGGGAGGCAGCAG-3′) and (5′-GGACTACHVGGGTWTCTAAT-3′) were utilized to amplify the V3-V4 region of the 16S rRNA gene for bacterial community analysis. PCR reactions were performed using the Eppendorf Thermal Cycler Pro S as follows: initial denaturation at 98 °C for 2 s, followed by 40 cycles of denaturation at 98 °C for 10 s, annealing at 60 °C for 30 s, and extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min. The PCR products were amplified and purified using the Agencourt AMPure XP Nucleic Acid Purification Kit after 1% agarose gel electrophoresis. High-throughput sequencing was performed by Ovison Gene Technology Ltd., Melbourne, Australia using the Illumina MiSeq platform.

The primers 338F (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R (5′-GGACTACNNGGGTATCTAAT-3′) (Munyaka et al., 2015 (link)) were used to amplify the V3-V4 hypervariable region of the bacterial 16S rRNA gene. An 8 bp barcode sequence was added at the 5′ end of each upstream and downstream primers to distinguish between different samples. Amplicons were separated on 2% agarose gels, purified using the AxyPrep DNA Gel Extraction Kit according to the manufacturer’s instructions, and quantified using QuantiFluor-ST. The purified amplicons were pooled in equimolar concentrations and paired-end sequenced (2 × 250) on the Illumina platform according to standard protocols. PCR reaction mixture (25 μL) contained 12.5 μL 2xTaq Plus Master Mix, 3 μL BSA (2 ng/μL), 1 μL Forward Primer (5 μM), 1 μL Reverse Primer (5 μM), 2 μL template DNA, and 5.5 μL ddH₂O. Reaction parameters were as follows: pre-denaturation at 95°C for 5 min followed by 28 cycles of denaturation at 95°C for 45 s, annealing at 55°C for 50 s, and extension at 72°C for 45 s, and a final step of extension at 72°C for 10 min. The PCR products were detected by 1% agarose gel electrophoresis to determine the size of the amplified target bands, which were then purified using the Agencourt AMPure XP Nucleic Acid Purification Kit.

The V3-V4 region of the 16S rDNA was amplified using specific primers with a barcode; the primer sequences were 338F: ACTCCTACGGGAGGCAGCAG; and 806R: GGACTACHVGGGTWTCTAAT. DNA was extracted using the kit (Omega Biotek, Norcross, GA, United States). By using 1% agarose gel electrophoresis to identify PCR products, they were then purified using the Agencourt AMPure XP nucleic acid purification kit. Equal quantities of the purified amplified products were mixed, and the “Y” shaped connection was connected. Magnetic bead screening was used to remove the connector’s self-connecting parts. The library template was enriched by PCR amplification to generate single-stranded DNA fragments, and MiSeq was used to construct and sequence the library.

Community structure of rat intestinal microbiota was analyzed by 16S rRNA gene sequencing technique. A genomic DNA isolation kit (MoBio Laboratories, Carlsbad, CA) was used to extract total DNA samples from the rat feces samples. The extracted DNA was detected by 1% agarose gel electrophoresis, and quality and concentration were determined using spectrophotometry. Paired-end sequencing was performed using the Illumina MiSeq PE300 high-throughput sequencing platform at Beijing Aoweisen Gene Technology Co., Ltd. The primers 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′) were used to amplify the bacterial 16S rRNA gene V4 region. The PCR products were detected by 1% agarose gel electrophoresis for amplification target band size and purified with an Agencourt AMPure XP Nucleic Acid Purification Kit. The raw sequences were uploaded to NCBI's SRA database. Pairs of reads were spliced into one sequence, and the data were optimized for OTU (97% similarity level) clustering analysis using the RDP Classifier algorithm. Diversity analysis and multilevel discriminate analysis size effect (LEfSe) were performed on all samples; environmental factor correlation analysis was performed using the Spearman correlation analysis.

The total mouse fecal genome was extracted, and intestinal flora was detected by sequencing the V3-V4 region of 16S rDNA on the Illumina MiSeq platform (Illumina, San Diego, CA, United States). The metagenomic DNA from mouse colonic contents was obtained using a FastDNA™ SPIN Kit (MP Biomedicals, CA, United States). The V3-V4 variable region was amplified using barcoded primers. The PCR product was detected by 1% agarose gel electrophoresis and purified with Agencourt AMPure XP Nucleic acid purification kit. The amplicons were then pooled in paired-end sequence on an Illumina MiSeq platform (Illumina, Journal Pre-proof 9 San Diego, CA, United States) by Beijing Allwegene Tech (Beijing, China) following the standard protocols. The detailed analytical information was indicated in Supplementary Methods.