The largest database of trusted experimental protocols

Quantstudio 5

Manufactured by Vazyme
Sourced in China

The QuantStudio 5 is a real-time PCR system designed for accurate and reliable quantitative analysis of nucleic acid samples. It features a 96-well format and supports a wide range of sample types and assay chemistries. The system provides precise temperature control and sensitive detection capabilities to enable quantitative gene expression analysis, genotyping, and other real-time PCR applications.

Automatically generated - may contain errors

4 protocols using quantstudio 5

1

Quantifying C3 Gene Expression in COPD

Check if the same lab product or an alternative is used in the 5 most similar protocols
Gene expressions of C3 were determined by qRT-PCR. Total RNA was isolated from the lung tissues of mouse and human COPD patients, and the cultured cells were treated with Trizol reagent (Thermo Fisher Scientific, MA, USA) and the Nano Drop 2000 was used to measure RNA concentration. RNA was then reverse transcribed into cDNA using the HiScript III RT Supermix for qPCR (+gDNA wiper) Kit (R323-01, Vazyme, Nanjing, China). The qPCR reactions were performed on the Applied Biosystems® QuantStudio® 5 in a 20 μl reaction system using the ChamQ Universal SYBR qPCR Master Mix Kit (Q711-02, Vazyme, Nanjing, China).
+ Open protocol
+ Expand
2

RNA Extraction and Differential Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cell tissues using a TRIzol reagent kit (Invitrogen). PCR was amplified and sequenced using Illumina NovaSeq 6000 by Gene Denovo Biotechnology (Guangzhou, China). We identified genes as significantly differentially expressed if they had a fold change ≥1 and a false discovery rate <0.05. Total RNA was isolated from osteosarcoma cell lines using the Total RNA Kit (R6834-01, Omega). One microgram of RNA was used for cDNA synthesis using a High-Capacity cDNA Reverse Transcription Kit (Q711-02, Vazyme). Transcript levels were determined on an Applied Biosystems QuantStudio 5 real-time PCR system using the Vazyme iTaq Universal SYBR Green Supermix (R223-01, Vazyme). Relative gene expression was calculated using the 2 -∆∆Ct method. The primer sequences are listed in Supplementary Table 2.
+ Open protocol
+ Expand
3

Quantitative Analysis of tRF-17-WS7K092 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Serum total RNA was extracted using a rapid blood total RNA extraction kit (BioTeke Corporation, China), while total RNA from tissues and cells was extracted using a TRIzol reagent (Invitrogen, Germany). cDNA was produced using the RevertAid RT Reverse Transcription Kit (Thermo Fisher Scientific, USA), and quantitative real-time PCR (qRT-PCR) was performed on ABI QuantStudio 5 with the 20 μL reaction system, which included 10 μL ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd., China), 1 μL primers, 3 μL enzyme-free water, and 5 μL cDNA. U6 was used as an internal reference, and the expression of tRF-17-WS7K092 was calculated by the 2−∆∆CT method. All primers used in the study were synthesized by RiboBio (Guangzhou, China).
+ Open protocol
+ Expand
4

RNA Extraction and RT-qPCR Analysis of GPR176

Check if the same lab product or an alternative is used in the 5 most similar protocols
TRIzol Reagent (Invitrogen, Germany) was used to extract the total RNA of tissue specimens, and Revert Aid RT Reverse Transcription Kit (ThermoFisher Scientific, USA) was used to produce cDNA. RT-qPCR was performed on ABI QuantStudio5 with 10 μL ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd, China), 0.5 μL primers (10 μM), 4 μL enzyme-free Water and 5 μL cDNA. GAPDH was used as an internal reference, and the expression of GPR176 was calculated by the 2−∆∆CT method. The sequences of primer used in this study were GPR176-F: GATGGTCTTCATCTTGTGTAGC, GPR176-R: CTCCCTGTACTGACCACATTAC; GAPDH-F: AGAAGGCTGGGGCTCATTTG, GAPDH-R: GCAGGAGGCATTGCTGATGAT.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!