Total RNA was extracted from the brain tissue of C57BL/6J mice using ExtractRNA (Evrogen, Moscow, Russia), treated with RNA-free DNase (Promega, Madison, WI, USA), and diluted to 0.125 µg/µL with diethyl pyrocarbonate-treated water. One microgram of total RNA was subjected to cDNA synthesis with a random hexanucleotide mixture [42 (link),43 (link),44 (link)]. The number of cDNA copies for all studied genes was evaluated by qPCR on a LightCycler 480 (Roche Applied Science, Rotkreuz, Switzerland) with specific primers (Table 1 ), SYBR Green I fluorescence detection (R-414 Master mix, Syntol, Moscow, Russia), and 50, 100, 200, 400, 800, 1600, 3200, or 6400 copies of genomic DNA as external standards. The calibration curve in the coordinates Ct (threshold cycle value) and minus log P (decimal logarithm of the amount of DNA standard) was plotted automatically using the LightCycler 480 System software. Gene expression is presented as the relative number of cDNA copies per 100 copies of DNA-dependent RNA polymerase 2 subunit A (Polr2a) cDNA, which served as an internal standard [42 (link),43 (link),44 (link)]. A melting-curve analysis was performed at the end of each run for each primer pair, allowing us to control the amplification specificity.
Extractrna
Manufactured by Evrogen
Sourced in China
ExtractRNA is a laboratory equipment product designed for the extraction and purification of RNA from various biological samples. It utilizes a specialized protocol to isolate high-quality RNA for downstream applications, such as gene expression analysis, reverse transcription, and RNA-based assays.
Automatically generated - may contain errors
Lab products found in correlation
Dnase 1, by Thermo Fisher Scientific (6 mentions)
Mmlv rt kit, by Evrogen (5 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (4 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Sybr green 1 dye, by Evrogen (3 mentions)
Qpcrmix hs sybr, by Evrogen (3 mentions)
Revertaid kit, by Thermo Fisher Scientific (3 mentions)
Dnase, by Thermo Fisher Scientific (3 mentions)
Cfx96 real time pcr system, by Bio-Rad (2 mentions)
Qpcr mix hs sybr master mix, by Evrogen (2 mentions)
Quantitect reverse transcription kit, by Qiagen (2 mentions)
Rna free dnase, by Promega (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Hematoxylin and eosin, by BioVitrum (1 mentions)
Mmlv kit, by Evrogen (1 mentions)
Cleanrna standard kit, by Evrogen (1 mentions)
Hs taq dna polymerase, by Evrogen (1 mentions)
Hydrochloric acid (hcl), by Merck Group (1 mentions)
Formaldehyde, by Merck Group (1 mentions)
Potassium hexacyanoferrate 2 trihydrate, by Merck Group (1 mentions)
25 protocols using extractrna
1
Quantifying Gene Expression in Mouse Brain
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the ExtractRNA (Evrogen, Russia). Concentrations of RNA were determined on a NanoDrop spectrophotometer (ND1000, NanoDrop Technologies, USA). First-strand cDNA synthesis was performed with the RevertAid Kit (Fermentas, European Union). Expression levels of the genes were measured by real-time PCR with the EVA Green Reagent Mix (Synthol, Russia) on a CFX96 real-time PCR system (Bio-Rad, USA). Gapdh and Hprt1 genes were chosen as an endogenous internal control. Triplicate real-time PCRs were performed on each sample. The fold-change in target gene expression (normalized to the controls) was calculated from threshold cycle values (Ct; CFX96 software). Sequences for all primers and probes can be found in Table S2 (supplementary material 1) (Synthol, Russia).
3
Plasma miRNA Extraction Protocol for ASD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasma samples were obtained from patients with diagnosed ASD. The samples were provided by the Mental Health Research Center and Laboratory of Molecular Cytogenetics of Neuropsychiatric Diseases, Veltischev Clinical Pediatric Research Institute, Pirogov Russian National Research Medical University (Moscow, Russia). Written informed consents were obtained from all study participants. Table 3 lists the information about the plasma samples studied herein.
The plasma samples were obtained in the following way. Firstly, blood samples were taken from the cubital vein before treatment on an empty stomach. The blood samples were collected into specialized containers with 3.8% CH3COONa (IMPROVACUTER, Guangzhou Improve Medical Instruments Co., Ltd., Guangzhou, China) and centrifuged (3000 rpm, 6 min, room temperature). The so-obtained 500-μL plasma samples were then placed into dry Eppendorf-type test tubes, frozen to −80 °C, and stored until their use in the experiments.
MiRNAs were isolated from the studied plasma samples with an ExtractRNA (Evrogen, Moscow, Russia) according to the protocol provided by the manufacturer. The so-isolated miRNA samples were diluted with 75% ethanol [38 ]. In the blank experiments, pure buffer solution was treated in the same way.
The plasma samples were obtained in the following way. Firstly, blood samples were taken from the cubital vein before treatment on an empty stomach. The blood samples were collected into specialized containers with 3.8% CH3COONa (IMPROVACUTER, Guangzhou Improve Medical Instruments Co., Ltd., Guangzhou, China) and centrifuged (3000 rpm, 6 min, room temperature). The so-obtained 500-μL plasma samples were then placed into dry Eppendorf-type test tubes, frozen to −80 °C, and stored until their use in the experiments.
MiRNAs were isolated from the studied plasma samples with an ExtractRNA (Evrogen, Moscow, Russia) according to the protocol provided by the manufacturer. The so-isolated miRNA samples were diluted with 75% ethanol [38 ]. In the blank experiments, pure buffer solution was treated in the same way.
4
Magnetic Nanoparticles for Biomedical Applications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Magnetic nanoparticles coated with glucuronic acid from Chemicell GmbH (Germany) specified as “50-nm fluidMAG-ARA”; hematoxylin and eosin from Biovitrum (Russia); potassium hexacyanoferrate (II) trihydrate, hydrochloric acid, and formaldehyde from Sigma-Aldrich (USA); K3-EDTA test tubes from Guangzhou Improve Medical Instruments (China); ExtractRNA, CleanRNA Standard kit, MMLV kit, HS Taq DNA Polymerase, and SYBR Green I dye from Evrogen (Russia) were used in the experiments. All other chemicals were of analytical grade.
5
Quantifying Gene Expression Changes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using ExtractRNA (Evrogen, Russia), and the subsequent cDNA synthesis was performed using QuantiTect Reverse Transcription Kit (Qiagen, Germany). Quantitative RT-PCR was performed using an Applied Biosystems StepONE Plus Real-Time PCR System (Thermo Fisher Scientific, USA) and qPCR mix-HS SYBR master mix containing SYBR Green I dye (Evrogen, Russia). The mRNA levels of genes of interest were quantified via ΔΔCt Relative quantification method with GAPDH as a housekeeping reference target. Each reaction had three technical replicates, and only the sybr green master mix was used as a negative template control. Primer sequences are listed in Table 2 below.
Oligonucleotide sequence of primers used for qPCR.
| Gene name | Forward: 5’-3’ | Reverse: 5’-3’ |
|---|---|---|
| α-SMA | CTGAAGAGCATCCGACAC | AGCCTGAATAGCCACATACAT |
| HAS2 | AGGTCGGTGTGAACGGATTTG | GAGAGCCTCAGGATAACT |
| Hyal1 | AACAAGTACCAAGGAATCAT | GAGAGCCTCAGGATAACT |
| Col1a1 | CCGCAAAGAGAGTCTACATGTC | CTGACTTCAGGGATGTCTTC |
| GAPDH | ACCTGCCAAGTATGATGA | GGAGTTGCTGTTGAAGTC |
| Col3a1 | AACACGCAAGGCAATGAGAC | AAGCAAACAGGGGCCAATGTC |
| CCL2 | CTCTTCCTCCACCACCAT | CTCTCCAGCCTACTCATTG |
| HRG | ACAGAAAGCAAGCCCTAAAG | GCAGAATCCAAAGACCAGAGG |
6
Quantifying Gene Expression from Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cultured cells was isolated using the ExtractRNA (Evrogen) according to the manufacturer’s manual. Coding DNA was obtained by reverse transcription of 1–2.5 μg of total RNA using the Revert Aid Kit (ThermoFisher Scientific, Waltham, MA, USA). Gene expression was evaluated by real-time qPCR (Roshe LightCycler, Basel, Switzerland) using EvaGreen dye (Biotium, Fremont, CA, USA). The RPLP0 mRNA levels were used for signal normalization. Results were analyzed using delta-delta Ct method. The list of primers is given in Table S1 . Experiments were carried out as at least two independent biological replicates, each reaction run in triplicate. Values are mean ± SD, statistical analysis was performed using GraphPad Prism 8.
7
Quantitative RT-PCR analysis of M3-receptor expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For real time PCR was used isolated atria and ventricles tissues from 3 groups of animal. After preparation samples were dipped into RNA stabilization solution (IntactRNA, Evrogen, Russia) for 24 h at 4 °C and stored at 20 °C before used. RNA was extracted from samples with the usage of acid-guanidine-phenol-chloroform method (ExtractRNA, Evrogen, Russia). RNA was treated from genomic DNA with the usage of DNase I (2000 е.а./ml, NEB,USA) for 60 min at 42 °C. Total RNA (500 ng) was reverse-transcribed by MMLV RT kit this random primers (Evrogen, Russia) according to the protocol recommended by the manufacturer.
Quantitative RT-PCR was carried out in a total volume 25 μl containing qPCRmix-HS SYBR (Evrogen, Russia) containing intercalating fluorescent dye SYBR Green I. The assay was performed using PCR detection system BioRad CFX96. Melting was initiated at 95 °C during 5 min. The cycling profiles were consisted of denaturation of 1 min at 95 °C, annealing of 30 s at 60 °C, extension of 30 s at 72 °C, for 50 cycles and final step of 10 min at 72 °C.
Sequences for primers were as follows: M3-receptors - СAAGTGGTCTTCATTGCCTTCT (forward), GCCAGGCTTAAGAGGAAGTAGTT (reverse) and GAPDH - CAGCGATGCTTTACTTTCTGAA (forward), GATGGCAACAATGTCCACTTT (reverse). For standard curves for RT-PCR was used serially diluted genomic DNA from rat liver.
Quantitative RT-PCR was carried out in a total volume 25 μl containing qPCRmix-HS SYBR (Evrogen, Russia) containing intercalating fluorescent dye SYBR Green I. The assay was performed using PCR detection system BioRad CFX96. Melting was initiated at 95 °C during 5 min. The cycling profiles were consisted of denaturation of 1 min at 95 °C, annealing of 30 s at 60 °C, extension of 30 s at 72 °C, for 50 cycles and final step of 10 min at 72 °C.
Sequences for primers were as follows: M3-receptors - СAAGTGGTCTTCATTGCCTTCT (forward), GCCAGGCTTAAGAGGAAGTAGTT (reverse) and GAPDH - CAGCGATGCTTTACTTTCTGAA (forward), GATGGCAACAATGTCCACTTT (reverse). For standard curves for RT-PCR was used serially diluted genomic DNA from rat liver.
8
Time-Course Phage Infection of A. baumannii
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A. baumannii 28 and 1432 cells were grown to OD600 of 0.45 and infected at an MOI of 10 with phages AS11 and AS12, respectively. Infection was stopped at 5-min intervals by rapid chilling. A 0-min time point stands for total RNA from A. baumannii 28 and 1432 cells that were not infected with the phages. Cells were collected by centrifugation at 5000 G for 15 min and used for total RNA purification with ExtractRNA (Evrogen JSC, Moscow, Russia).
9
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using ExtractRNA (Evrogen, Moscow, Russia). A measure of 1 μg RNA was reverse-transcribed to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany), and quantitative RT-PCR was performed using an Applied Biosystems StepONE Plus Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) and qPCR mix-HS SYBR master mix containing SYBR Green I dye (Evrogen, Moscow, Russia). The mRNA levels of genes of interest were quantified via the ΔΔCt relative quantification method proposed by [16 (link)], with GAPDH as a housekeeping reference target. A primer list is provided in the Supplementary Materials, Table S1 .
10
Extraction and RT-PCR of DNA and RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was isolated from 1 × 106 fibroblasts cells or 5 × 106 hPBMC with Extract DNA Blood & Cells kit (Evrogen, Moscow, Russia) following the manufacturer’s instructions. Total RNA was isolated from 2–4 × 106 cells with ExtractRNA (Evrogen, Moscow, Russia) following the manufacturer’s instructions. Two micrograms of total RNA were treated with DNAse I (ThermoFisher Scientific, Waltham, MA, USA), then after thermal inactivation of DNAse In the presence of EDTA, 1 µg of RNA was used for reverse transcription with a MMLV RT kit (Evrogen, Moscow, Russia), using random (deca-nucleotides) primers for synthesis. RT-PCR was carried out by Encyclo Plus PCR kit (Evrogen, Moscow, Russia) using 1.5 μL of 1:40 dilutions of cDNA template as the templates. Each of the specific primers was used in 10 µM amounts.
Luna Universal One-Step RT-PCR Kit (New England BioLabs, Ipswich, MA, USA) was used for one-tube RT-PCR with 1 µg of RNA with specific primers (the list of primers is shown in theSupplementary Materials ). The thermal cycler C1000 Touch (Bio-Rad, Hercules, CA, USA) was used as the equipment for amplification.
Luna Universal One-Step RT-PCR Kit (New England BioLabs, Ipswich, MA, USA) was used for one-tube RT-PCR with 1 µg of RNA with specific primers (the list of primers is shown in the
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!