Dynabeads m 280

A synthetic nanobody phage display library with high diversity was prepared as previously described.^{30 (link)} Screening for nanobodies was performed by panning in both immunotubes and with magnetic bead-conjugated antigen, using SARS-CoV-2 variants P.1 and B.1.617 derived recombinant RBD proteins. Briefly, for the 2nd and 4th panning rounds, the purified SARS-CoV-2 RBD proteins were coated on Nunc MaxiSorp immunotubes (ThermoFisher) at 5 µg/mL in PBS overnight. For the 1st and 3rd panning rounds, RBD protein was first biotinylated with EZ-Link™ Sulfo-NHS-LC-Biotin (ThermoFisher) and then selected with streptavidin-coated magnetic Dynabeads™ M-280 (ThermoFisher). The panning was performed according to a standard protocol.^{30 (link)} After four rounds of panning, phage ELISA identification was performed with 960 individual colonies using Anti-CM13 antibody in the plates coated with recombinant RBDs. The absorbance was measured using a SpectraMax M5 plate reader from Molecular Devices (San Jose, CA, USA). The positive clones were sent for sequencing. After sequence alignments, the distinct sequences were chosen for protein expression.

Phages displaying VHHs specific for the RBD of SARS-CoV-2 were enriched after two rounds of bio-panning on 50 nM and 2 nM of biotinylated RBD respectively, through capturing with Dynabeads™ M-280 (Thermo Fisher Scientific). Enrichment after each round of panning was determined by plating the cell culture with 10-fold serial dilutions. After the second round of panning, 93 individual phagemid clones were picked, VHH displaying phages were recovered by infection with M13K07 helper phage and tested for binding to RBD by a combination of competition and inhibition ELISAs. In these assays, RBD was immobilised on a 96-well plate and binding of phage clones was measured in the presence of excess soluble RBD (inhibition ELISA) or the RBD-binding H11-H4-Fc^{25 (link)} (competition ELISA). Bound phage were detected with an HRP-coupled anti-M13 antibody (1:5000; Cytiva 27-9421-01).
Phage binders were ranked according to the inhibition assay and then classified as either competitive with H11-H4 (i.e., sharing the same epitope) or non-competitive (i.e. binding to a different epitope on RBD). Clones were sequenced and grouped according to CDR3 sequence identity.

Dot1p was expressed from pET21a-TEV-MBP and purified. The MBP tag was removed by TEV cleavage reaction. The biotinylated N-terminal H4 tail (amino acids 1–21) fragment was bound to streptavidin-coated Dynabeads M280 (Thermo Fisher Scientific; 11205D) in coupling buffer (25 mM Tris-HCl, pH 8.0, 1 M NaCl, 1 mM dithiothreitol (DTT), 5% glycerol, 0.03% NP-40) at 4 °C for overnight. Purified Dot1 and the bead-bound H4 tail peptides were mixed in peptide-binding buffer (25 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM DTT, 5% glycerol, 0.5% Triton X-100) and incubated at 4 °C for 1 h. After washing five times with wash buffer (peptide-binding buffer containing 200 mM NaCl), the samples were analyzed by SDS-PAGE and subjected to western blotting.

The capture assays were performed in 20 µl DNA annealing buffer supplemented with 0.05% Tween-20. The reactions were assembled on ice and, where indicated, 82 nM RPA, 10 nM biotinylated dT43 (bio-dT43) and 10 nM 3′Cy3–dT79 were added to reactions. Next, HELQ was added to reactions as indicated. Reactions were mixed and incubated at 37 °C for 8 min in the dark. To pull-down bio–dT43, magnetic streptavidin beads were washed twice with PBS-0.1% Tween-20 (Dynabeads M-280, Thermo Fisher Scientific) and 5 µl of beads was added to each reaction. Reactions were further incubated for 4 min in the dark at room temperature and then washed twice with 80 µl washing buffer (25 mM Tris-HCl pH 8.0, 2 mM ATP, 2 mM MgCl₂, 1 mM DTT, 100 mM NaCl, 0.5 mg ml⁻¹ bovine serum albumin, NP-40) on a magnetic rack. Finally, the beads were resuspended in 30 µl loading buffer (7.5 µl 2% stop solution and 22.5 µl washing buffer) and boiled at 95 °C for 4 min. The samples were centrifuged at high speed for 1 min and 25 µl volume sample was loaded immediately on 10% native polyacrylamide gel and run as described for the unwinding assay. The gels were directly imaged in the ChemiDoc MP imaging system (Bio-Rad).

2 × 10⁶ K562 cells were incubated with N-terminally biotinylated peptides (c(peptide) = 10 μM, t = 2.5 h) for uptake on a rotating wheel at 37°C. The cells were extensively washed in PBS and lysed in lysis buffer (25 mM HEPES, pH 7.5, 150 mM NaCl, 0.05% IGEPAL CA-630, 1 mM EDTA) supplemented with 0.5 U/μl RNAse inhibitor (Superase-in, ThermoFisher). The lysate was cleared by centrifugation at 21 000 g at 4°C, an aliquot of the supernatant was removed and re-suspended in Trizol, while the remaining was incubated with streptavidin-coupled magnetic beads (Dynabeads M280, ThermoFisher) on a rotating wheel (2 h, 4°C). After magnetic separation and washing (3× in lysis buffer), the beads were re-suspended in 20 μl lysis buffer, re-suspended in Trizol (ThermoFisher), and 400 ng t-RNA was added per sample as a carrier. RNA was extracted from Trizol using the standard protocol and the qRT-PCR was performed according to a previously published protocol (62 (link)) using the primers h-miR21-3p-FW (CAGCAACACCAGTCGATG), h-miR21-3p-RV (GGTCCAGTTTTTTTTTTTTTTTACAG), h-miR21-5p-FW (GCAGTAGCTTATCAGACTGATG), h-miR21-5p-RV (GGTCCAGTTTTTTTTTTTTTTTCAAC) in a CFX96 real-time machine (Bio-Rad). The relative enrichment was calculated as a ratio of copies in the immunoprecipitate over input normalized to the enrichment of the control peptide D1.