First-strand cDNA synthesis was performe4d with 200 ng/total RNA from each sample using the miScript II RT kit with miScript HiSpec Buffer (Qiagen) following manufacturer protocol. Briefly, cDNA synthesis was performed at 37°C for 60 min followed by inactivation at 95°C for 5 min. First-strand cDNA was diluted 1:10 in molecular grade water and expression of 84 miRs having a role in T or B cell function was assessed using a miScript miR PCR Array Mouse T cell and B cell Activation (Qiagen) array following the manufacturer's protocol on a Stratagene Mx3000P/3005P real-time instrument. Each array plate contains oligos specific to 84 mature miRs validated to regulate T cell or B cell development and function as well as oligos for spike in (C. elegans miR-39), six housekeeping genes [small nucleolar/nuclear RNA (snoRNAs) SNORD61, SNORD95, SNORD96A, SNORD68, SNORD72, and RNU6B] and positive and negative controls for reverse transcription and PCR. Data obtained were analyzed with miScript miR PCR analysis template (Qiagen) using the ΔΔCT method (116 (link)). miRs with fold change ≥2 were considered upregulated while miRs with fold change ≤ 0.5 were considered downregulated. RT-qPCR using miR-specific primers was then performed on differentially expressed miRs between treatment groups using a PCR array. The specificity of amplification was validated by dissociation curve analysis.
Miscript hispec buffer
Manufactured by Qiagen
Sourced in Germany
The MiScript HiSpec Buffer is a laboratory reagent used in the analysis of microRNA (miRNA) expression. It is designed to provide high specificity for the detection and quantification of mature miRNA molecules. The buffer is part of the miScript system, a comprehensive platform for miRNA analysis.
Automatically generated - may contain errors
Lab products found in correlation
Miscript 2 rt kit, by Qiagen (17 mentions)
Miscript sybr green pcr kit, by Qiagen (10 mentions)
Mirneasy mini kit, by Qiagen (6 mentions)
Miscript pcr system, by Qiagen (5 mentions)
Miscript reverse transcriptase mix, by Qiagen (4 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (4 mentions)
Miscript primer assay, by Qiagen (4 mentions)
Miscript hiflex buffer, by Qiagen (4 mentions)
Miscript 2 reverse transcription kit, by Qiagen (3 mentions)
Rt2 sybr green qpcr mastermix, by Qiagen (2 mentions)
Rotor gene q thermocycler, by Qiagen (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Miscript sybr green real time pcr kit, by Qiagen (2 mentions)
Miscript universal primer, by Qiagen (2 mentions)
Quantitect sybr green pcr master mix, by Qiagen (2 mentions)
Miscript nucleics mix, by Qiagen (2 mentions)
Qiazol, by Qiagen (2 mentions)
Miscript reverse transcription kit, by Qiagen (2 mentions)
Steponeplus system, by Qiagen (1 mentions)
Miscript mirna pcr array human breast cancer mihs 109z, by Qiagen (1 mentions)
29 protocols using miscript hispec buffer
1
Profiling miRNA Expression in T/B Cells
2
miRNA Profiling in hBM-MSC Passages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miRNA levels in hBM-MSCs of early and late passages were analyzed with miRNome miScript miRNA PCR Array (MIHS-216ZR-4, SABiosciences, Qiagen). Template cDNA was synthesized from 600 ng of the total RNA with miScript II RT Kit using miScript HiSpec Buffer (Qiagen) following manufacturer's protocol. The templates were mixed with RT2 SYBR Green qPCR Master Mix (Qiagen) and 20 μl aliquoted into each well of 5 PCR arrays. Each array consisted of a panel of 96 primer sets of 84 miRNAs of interest, 2 C. elegans miR-39, and 10 controls. PCR was performed in Rotor-Gene Q thermocycler (Qiagen), as follows: 15 min at 95°C and 40 cycles of 15 sec at 94°C, 30 sec at 55°C, and 30 sec at 70°C. Each sample was tested in technical duplicate. The miRNA data were analyzed using online software miScript miRNA PCR Array Data Analysis. The relative expression of each target miRNA was determined with the ΔΔCt method and normalized to the geometric mean of 6 small RNAs (SNORD61, SNORD68, SNORD72, SNORD95, SNORD96A, and RNU6-2) according to SABioscience guide. A miRNA was considered differentially expressed if it showed more than two-fold change and P value < 0.05 indicated significance.
3
Quantifying microRNA Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression of the 10 selected microRNAs was performed by 2-step qRT-PCR. First, 0.8 μg RNA was reverse transcribed by using the miScript II RT Kit (Qiagen) and miScript HiSpec Buffer as described by the manufacturer. The synthesized cDNA was then diluted 10 times with nuclease-free water to yield a total volume of 200 μL.
MicroRNA expression and expression of 2 reference RNAs, SNORD68 and RNU-6, were quantified by qPCR by using the Applied Biosystems StepOnePlus system and miScript SYBR Green PCR Kit (Qiagen) as described by the manufacturers.
MicroRNA expression and expression of 2 reference RNAs, SNORD68 and RNU-6, were quantified by qPCR by using the Applied Biosystems StepOnePlus system and miScript SYBR Green PCR Kit (Qiagen) as described by the manufacturers.
4
Breast Cancer MicroRNA Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
250 ng of the eluted RNA sample was used to make cDNA using a miScript RT II kit with miScript HiSpec buffer from Qiagen (Qiagen, Hilden, Germany). Briefly, the reaction was set up in the thermal cycler for 60 min at 37 °C followed by 5 min at 95 °C. The cDNA was then diluted with 200 μl of RNase-free water. For RT-qPCR a total of 2750 μl was prepared, made up of (2 x QuantiTect SYBR green PCR master mix, 10 x miScript universal primers with a cDNA template and RNase free water). MicroRNAs screening was performed using miScript miRNA PCR Array Human Breast Cancer-MIHS-109Z (Qiagen, Hilden, Germany). The miRNA PCR Array Panel contains 84 mature miRNAs most relevant to breast cancer tumorigenesis. The final reaction volume was 25 μl per well, enough to provide 1 ng cDNA per well. The plates were run following a thermal cycling protocol: 95 °C for 15 min to activate the HotStar Taq DNA polymerase, 40 amplification cycles of 15 s at 94 °C, 30 s at 55 °C, 30 s at 70 °C and at the end a melting curve program. All qPCR reactions were run in duplicate.
5
Profiling Cancer-Related miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from PC9/6M and PC9/ER using the TRI reagent (Molecular Research Center, Cincinnati, OH, USA). The cDNA synthesis was performed using 1000 ng of total RNA, based on the recommended protocol, using the miScript HiSpec Buffer (Qiagen, Hilden, Germany) (37°C for 60 min and then at 95°C for 5 min). After the dilution of cDNA, PCR array was performed based on a SybrGreen protocol and using human tumor suppressor gene miScript miRNA PCR array (MIHS‐119Z) (Qiagen) following the manufacturer's protocol. These arrays contain the probes for 92 miRNAs whose expression has been known to be altered in human cancer. The quantitative real‐time PCR reaction was performed in the 7500 Fast Real‐Time PCR system (Applied Biosystems, Foster City, CA, USA) following the program: 95°C for 15 min and then 40 cycles of 94°C for 15 s, 55°C for 30 s and 70°C for 30 s. The analysis of miRNA expression was performed using the data analysis portal provided by Qiagen (https://dataanalysis.qiagen.com/mirna/arrayanalysis.php ).
6
Reagents for RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anaesthetic ether, xylene, chloroform and formalin were purchased from Beijing Chemical Works (Beijing, China). Ethanol was obtained from Shandong LIRCON Medical Technology Co., Ltd. TRIzol RNA isolation reagent was purchased from Invitrogen (Carlsbad, USA). miScript HiSpec Buffer, miScript Nucleics Acid Mix, miScript Reverse Transcriptase Mix, RNase-free water oligo primer, reaction buffer, dNTPs, revertase, and RNase inhibitor were obtained from Qiagen (Dusseldorf, Germany).
7
Analyzing miRNA Profiles in Neuronal Compartments
8
Quantifying Mature miRNA Expression in Immune Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from approximately two million purified NCD4hi, NCD4lo, ANCD4 and YNCD4 cells using Trizol (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. For cDNA synthesis 1 μg RNA was used for each sample using the MiScript HiSpec buffer from the miScript-II RT kit to get mature miRNA (Qiagen, Limburg, Netherlands). The miRNA real time PCR assays were performed for mature miRNAs using commercial kits (miScript Primer Assays for Mm_miR-181a_2, targeting the sequence AACAUUCAACGCUGUCGGUGAGU, along with miScript SYBR Green PCR kit, both from Qiagen). Recommended protocols were used to obtain Ct values. ΔΔCt values were calculated using miRNA-142 as a normalizing control (miScript Primer Assays for Mm_miR-142-5p_1 targeting CAUAAAGUAGAAAGCACUACU, from Qiagen) based on a published report [8 (link)].
9
Evaluation of Exosomal miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression of exosomal miRNAs (miR-10b-3p, miR-122-5p, miR-222-3p, miR-370-3p, miR-320b, miR-605-3p) was evaluated with a miScript PCR System (QIAGEN, Hilden, Germany). Reverse transcription reactions were carried out using a miScript II RT Kit (QIAGEN, Hilden, Germany), and miScript HiSpec Buffer for cDNA synthesis was used for the detection of mature miRNA. Quantitative real-time PCR was performed with a miScript SYBR Green PCR Kit (QIAGEN, Hilden, Germany). Mature miRNAs were identified via miScript Primer Assay. miR-39 was used as an external control.15 (link) The average Ct value for each RNA was obtained from triplicate reactions. Expression levels of miRNAs were calculated using 2^(-ΔCt), and fold changes of miRNAs were obtained by comparison of expression between case and control groups.
10
Mouse Endometrial RNA Extraction and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mouse endometrial tissues or cultured cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. RT of cDNA was conducted using the miScript II Reverse Transcription kit with miScript HiSpec Buffer (Qiagen, Inc., Valencia, CA, USA,). Briefly, RNA was mixed with miScript HiSpec Buffer, RNAse-free water and miscript Reverse Transcriptase Mix, and was incubated at 37°C for 60 min and 95°C for 5 min. qPCR was conducted with the miScript SYBR-Green Real Time PCR kit (Qiagen, Inc.) for miRNA detection and SYBR Premix Ex Taq. The specific primers for mmu-miR-96, U6, Bcl2, decidual/trophoblast prolactin-related protein (dtPRP) and β-actin were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) (Table I ). The qPCR master mix (15 µl) contained 7.5 µl SYBR Premix Ex Taq, 0.6 µl primers, 1.2 µl cDNA and 5.1 µl diethylpyrocarbonate-treated H2O. The thermocycling conditions were as follows: Initial denaturation at 95°C for 30 sec; 40 cycles at 95°C for 5 sec (denaturation) and 60°C for 30 sec, followed by 72°C for 5 sec. Experiments were performed in triplicate. Data obtained from qPCR were analyzed using the 2-ΔΔCq method (26 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!