Explants were harvested from each group at day 0 (baseline) and day 7 (n=5–6/group/day). Explants were immediately flash frozen with liquid nitrogen and stored at −80°C until RNA extraction. Samples were placed in Trizol reagent, homogenized with a bead homogenizer (Benchmark Scientific), and then separated using phase-gel tubes (Qiagen)[28 (link)]. The supernatant was then purified according to the Zymo Quick-RNA purification kit protocol (Zymo Research). The RNA was then converted into cDNA with reverse transcription and qPCR was performed with the Applied Biosystems StepOne Plus RT-PCR (Applied Biosystems, Foster City, CA). Primer pairs and sequences are listed in the Supplemental Data (Supplemental Table S1 ). We measured genes responsible for matrix synthesis (Col1a1), regulation of collagen fibrillogenesis (Fmod, Dcn, Bgn), matrix degradation (Mmp3, Mmp8, Mmp9, Mmp13), as well as markers of injury (Il6, Il1b, Tnfa, Casp3). Expression for each gene was calculated from the threshold cycle (Ct) value and was normalized to the housekeeping gene β-Actin. All data is represented in log space.
Steponeplus rt pcr
Manufactured by Thermo Fisher Scientific
Sourced in United States
The StepOnePlus Real-Time PCR System is a compact, user-friendly instrument designed for quantitative polymerase chain reaction (qPCR) analysis. It provides accurate, reliable results for a wide range of applications, including gene expression analysis, microRNA profiling, and pathogen detection.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Power sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Bead homogenizer, by Benchmark Scientific (1 mentions)
Hiseq x ten, by Illumina (1 mentions)
Next ultra directional rna library prep kit, by Illumina (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis, by Thermo Fisher Scientific (1 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (1 mentions)
Ambion trizol plus rna purification kit, by Thermo Fisher Scientific (1 mentions)
Random hexamer, by Thermo Fisher Scientific (1 mentions)
Revertaid h minus reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Tetro cdna synthesis kit, by Meridian Bioscience (1 mentions)
Sypro orange, by Thermo Fisher Scientific (1 mentions)
Sybr green, by Thermo Fisher Scientific (1 mentions)
Superscript 4 vilo master mix, by Thermo Fisher Scientific (1 mentions)
12 protocols using steponeplus rt pcr
1
Quantification of Extracellular Matrix Gene Expression
2
Transcriptome Profiling of Biological Specimens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five out of 47 pairs of specimens were selected for sequencing. The preparation of whole transcriptome libraries and deep sequencing were conducted by Hua Da Gene Corp., Ltd. (Shenzhen, China). The whole transcriptome libraries were established using the New England Biolabs (NEB) Next Ultra Directional RNA Library Prep Kit for Illumina according to the manufacturer’s instructions. Libraries were tested for quality using the Agilent 2100 Bioanalyzer system and the StepOnePlus RT-PCR (Applied Biosystems, USA) system. The qualified libraries were sequenced on an Illumina HiSeq X Ten instrument in paired-end form, generating 150 nucleotides. Clean reads were aligned to the human genome (GRCh38) using the HISAT program (18 (link)) and alignment results were reconstructed with cuff compare. The NONCODE and Pfam databases were used as annotation references for lncRNA and mRNA analyses. INFERNAL (19 (link)) was used to predict lncRNAs. CIRI (20 (link)) and find_circ (10 (link)) were used to predict circRNAs. The read count of each transcript was normalized in the form of fragments per kilobase of exon per million mapped reads (FPKM). In our study, differentially expressed genes and transcripts were identified using the following criteria: |log2(fold-change)| ≥1 and P value ≤0.05 between the two samples.
3
Reverse Transcription and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We utilized a high capacity cDNA reverse transcription Kit (Applied BioSystems, Foster City, CA, USA) to measure the mRNA level. Approximately 1 μg of RNAs from the different samples was reverse transcribed using 5.8 μl of master mix. The mixture was incubated for 10 min at 25 °C, then 37 °C for another 120 min, and finally 85 °C for 5 min. Quantitative-PCR was performed in triplicate on all samples using SYBR Green PCR Master mix (Life Technologies), cDNA sample. The following primers were used FBXL5: F: 5′ AAGTGGACGTCTTCACCGC, R: 5′ AAGACTGCAGAAGAGCACGG; Snail1 F: 5′ GTTTACCTTCCAGCAGCCCT, R: 5′ TCCCAGATGAGCATTGGCAG; E-Cadherin: F: TGGAGGAATTCTTGCTTTGC: R: CGTACATGTCAGCCAGCTTC. CD24: F: 5′ GCTCCTACCCACGCAGATTT. R: 5′ GCCTTGGTGGTGGCATTAGT using the StepOnePlus RT-PCR (Applied BioSystems). Relative expression of mRNAs was analyzed by utilizing the Ct method and was normalized to GAPDH.
4
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using the RNeasy Mini Kit (Qiagen Inc.). RNA was reverse-transcribed using the iScript cDNA Synthesis Kit (Bio-Rad). Reverse transcription polymerase chain reaction (RT-PCR) was performed using StepOne Plus RT-PCR (Applied Biosystems) with Power SYBR Green Master Mix (Thermo Fisher Scientific) following the manufacturer’s protocol. The melting curve and cycle threshold (Ct) of the gene of interest and the housekeeping gene (RPLP0) were recorded. The relative mRNA expression level (ΔCt) was calculated by subtracting the housekeeping gene Ct value from the target gene Ct value. Results are presented as means ± SD. The primer sequences are listed in table S2.
5
Quantification of Arginine-Related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Constructs were isolated and total RNA was immediately extracted using TRIzol according to standard protocols (Ambion TRIzol Plus RNA Purification Kit, Life technologies, Carlsbad, CA, USA) [29 (link)]. cDNA was then synthesized (SuperScript III First-Strand Synthesis, Invitrogen, Carlsbad, CA, USA) and stored at −80 °C until further analysis. TaqMan probes for the housekeeping gene, glyceraldehyde-3-phosphate (GAPDH), and arginine-related genes (arginase (ARG1), eNOS (NOS3), iNOS (NOS2), and ornithine D (OAT)) were incubated with 10 ng of cDNA and addition of the Taqman Fast Advanced Master Mix (Applied Biosystems, Foster City, CA, USA) in separate reactions followed by analysis on a RT-PCR thermocycler (StepOnePlus RT-PCR, Applied Biosystems, Foster City, CA, USA).
6
Quantitative RT-PCR Analysis of Mosquito Transgenics
7
Quantitative RT-PCR for M6A Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA isolated with TRIzol reagent (Invitrogen) was reversely transcribed using the Tetro cDNA Synthesis Kit (Bioline). RT‐PCR reactions were performed using SYBR Green Master Mix (Thermo Scientific) on the Step One Plus RT‐PCR (Applied Biosystems). The following primers were used for RT‐PCR: ALKBH5 forward (F), 5′‐TCA GCA TCG GAA CCA GCA AAG‐3′; ALKBH5 reverse (R), 5′‐TCC TGA CTG ACC TTC TTG CTC‐3′; FTO forward (F), 5′‐GTT GGA ACA TGG ATA GCC GC‐3′; FTO reverse (R), 5′‐CAA TGC TGT CGG CAC TTT CA‐3′; NANOG forward (F), 5′‐TTT GTG GGC CTG AAG AAA ACT‐3′ and reverse (R), 5′‐AGG GCT GTC CTG AAT AAG CAG‐3′; SOX2 forward (F), 5′‐GCC GAG TGG AAA CTT TTG TCG‐3′ and reverse (R), 5′‐GGC AGC GTG TAC TTA TCC TTC T‐3′. ACTIN was used as the reference gene for normalization. PCR products were assessed by melting curve analysis. Relative mRNA levels of target genes were calculated by the 2−ΔΔCt method.
8
Thermal Stability Analysis of cSOD1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The structural stability of cSOD1s was examined using DFS. For experiments using apo-cSOD1, recombinant cSOD1 proteins were diluted to 100 µM with 40 mM sodium phosphate (pH 7.4). EDTA (10 mM) and SYPRO Orange (Thermo Fisher Scientific, Waltham, MA, USA) were added to the solutions. DFS experiments were carried out using StepOnePlus RT-PCR (Applied Biosystems, Waltham, MA, USA) with temperature ramp of 1 °C per min between 25 °C and 95 °C. This experiment was repeated three times.
9
Gene Expression Analysis of Ovarian Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from OC cell lines were extracted via RNeasy Mini Kit (Qiagen Inc.) and reverse transcribed by iScript cDNA Synthesis Kit (Bio-Rad). RT-PCR was performed through StepOne Plus RT-PCR (Applied Biosystems) using Power SYBR Green Master Mix (Thermo Fisher Scientific) All procedure was following manufactures’ instructions. RT-PCR reaction generated a melting curve and cycle threshold (Ct) was recorded for the gene of interested and house-keeping control gene (PPIA). The relative RNA expression level was calculated as ΔCt and normalized by subtracting the Ct value of target gene from that of control gene. Results are presented as means + SD. Measurements were performed in biological triplicate and each biological replicate includes three technical replicates. Primer sequences are listed in Supplementary Table 3 .
10
iPSC RNA Quantification Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!