Qpcrbio sygreen blue mix lo rox

Total RNA was extracted from cells using TRIzol Reagent (Life Technologies) according to the manufacturer’s instructions. One microgram of total RNA was reverse transcribed into cDNA using a qPCRBIO cDNA synthesis kit (#PB30.11, PCR Biosystems Inc.; London, UK). qRT-PCR reactions were then performed using 2× qPCRBIO SyGreen Blue Mix Lo-ROX (PCR Biosystems Inc.) as per the manufacturer’s protocol and run on Quantstudio5 Real-time PCR log (Thermo Fisher Scientific; Massachusetts, USA). Specific primer sequences used in this study are listed in S1 Table. Each test was repeated three times, independently.

Real-time PCR was conducted using qPCRBIO SyGreen Blue Mix Lo-ROX (PCR Biosystems Ltd., London, UK) according to the manufacturer’s instructions. The PCR reaction was performed using a real-time CFX96 thermal cycler (Bio-Rad Laboratories Inc., Hercules, CA, USA) under the following conditions for 44 cycles: 10 s denaturation time at 95 °C, 10 s annealing time at 58 °C, and 60 s extension time at 72 °C. The expression of the atrogin-1, MuRF1, myogenin, myostatin, FNDC5, BDNF, TGF-β, and IL-6 genes was normalized to GAPDH and is expressed as the fold increase. The sequences of the primers used in this study are given in Table 1.

The copy number of bacterial 16S ribosomal RNA genes in rehydrated aliquots was measured in 20 µL reactions, consisting of 0.8 µL of each of the primers 341F (5′-CCTAYGGGRBGCASCAG-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′), 10 µL of 2 × qPCRBIO SyGreen Blue Mix Lo-ROX (PCR Biosystems Inc., Wayne, PA, USA), 2 µL of sample (diluted 10 times to avoid inhibition of PCR) and 6.4 µL of H₂O. The PCR mixes were heated to 95 °C for 180 s, and then subjected to 45 cycles of 95 °C for 5 s and a final melt at 60 °C for 30 s on a LightCycler^® 96 real-time PCR instrument (Roche Life Science, Hvidovre, Denmark). Fungal ITS2 copy numbers were measured in the same way, but with 0.8 µL of each of the primers ITS4 (5′-TTCCTSCGCTTATTGATATGC-3′) and ITS7 (5′-GTGARTCATCGARTCTTTG-3′) in 20 µL reactions. The measurements from one sample, for which the copy numbers of bacterial 16S ribosomal RNA genes and fungal ITS2 regions were 2–3 orders of magnitude lower than the other 47 samples, were deleted from the dataset. Copy numbers were expressed per g dry weight (dwt) soil (105 °C for 18 h).

C6/36 cells were infected with CHIKV (MOI 2) and treated with inhibitory compounds as described above. At 24 hpi, total RNA was extracted from cells using TRI Reagent Solution (Applied Biosystems) according to the manufacturer’s instructions. RNA integrity was confirmed by denaturing ageraose gel electrophoresis before reverse transcription of 1 μg of RNA using the High-Capacity RNA-to-cDNA Kit (Applied Biosystems) according to the manufacturer’s protocol. Quantitative PCR was performed using the qPCRBIO SyGreen Blue Mix Lo-ROX (PCR Biosystems) with primers amplifying a 78 bp region of the CHIKV nsP1 encoding sequence (fwd primer: 5’CCGACTCAACCATCCTGGAT’3, rev primer: 5’GGCAGACGCAGTGGTACTTCCT’3), 100ng of cDNA template and a PCR program as described above. In vitro transcribed CHIKV ICRES RNA was reverse transcribed and a cDNA dilution series employed as a standard to quantify copy numbers in the respective samples. All experiments were performed in three independent repeats, each consisting of 2 wells/condition. A one-way ANOVA was employed and Dunnett’s multiple comparisons test was performed, comparing each sample to the untreated control sample.

Huh7 cells were infected with CHIKV and treated with inhibitory compounds as described above. At 6 hpi, total RNA was extracted from cells using TRI Reagent Solution (Applied Biosystems) according to the manufacturer’s instructions. Strand-specific qPCR (ssqPCR) was performed according to the protocol described by Plaskon and colleagues [26 (link)]. Briefly, 500 ng of RNA were reverse-transcribed with gene specific primers (S1 Table) using the SCRIPT cDNA Synthesis Kit (Jena Bioscience) according to the manufacturer’s protocol. 100ng of strand-specific cDNA was used as template for the quantitative PCR performed with the qPCRBIO SyGreen Blue Mix Lo-ROX (PCR Biosystems) with gene specific primers (S1 Table) amplifying a 94 bp region of the CHIKV nsP1 encoding sequence using the following PCR program: 95°C for 2 mins, 40 x (95°C for 5 sec, 60°C for 30 sec), dissociation curve 60°C-95°C as pre-defined by the Mx3005P thermal cycler (Agilent technologies). In vitro transcribed CHIKV ICRES RNA was reverse transcribed and a cDNA dilution series employed as a standard to quantify copy numbers in the respective samples. All experiments were performed in four independent repeats, each consisting of 2 wells/condition. A one-way ANOVA was employed and Dunnett’s multiple comparisons test was performed comparing each sample to the untreated control sample.

Total RNA was isolated from the calf muscle or C2C12 cells using TRIzol reagent according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized from 1 μg total RNA using a cDNA synthesis kit. Real-time PCR was conducted using the qPCRBIO SyGreen Blue Mix Lo-ROX (PCR Biosystems Ltd., London, UK) according to the manufacturer’s instructions. The PCR reaction was performed using a real-time C1000 thermal cycler (Bio-Rad Laboratories Inc., Hercules, CA, USA) under the following conditions: 10 s denaturation time at 95 °C, 10 s annealing time at 58 °C, and 60 s extension time at 72 °C, for 39 cycles. The gene expression of atrogin-1, MuRF1, FoxO1, and FoxO3a was normalized to GAPDH and expressed as fold increase (normal level was set as 1). The sequences of the primers used in this study are shown in Table 1.