Sybr green detection

RNA was isolated using TRIzol reagent (Molecular Research Center, Inc., Cincinatti, OH, USA) according to the manufacturer’s instructions. RNA integrity was verified using an RNA chip (Agilent bioanalyzer, Santa Clara, CA, USA). One microgram of RNA was used to synthesize cDNA (20 µL reaction) (Bio-Rad’s Iscript select cDNA synthesis kit) according to the manufacturer’s protocol. The cDNA was diluted 1:10 and used for qRT-PCR with SYBR green detection (Invitrogen, Waltham, MA, USA). Phusion HF reaction buffer, Phusion HF DNA polymerase, and dNTPs used for qRT-PCR were purchased from New England Biolabs. Bio-Rad CFX96 Touch real-time PCR detection system was also used. Biorad CFX manager software was used to calculate fold changes in the gene expression. HPRT housekeeping gene was used as an internal reference for normalisation. All primer sequences are listed in Supplementary Table S3. All nucleotide metabolism genes (NMGs) are defined in Supplementary Table S3.

RNA was isolated using Qiagen RNeasy Plus Mini Kit as per the manufacturer’s instructions. cDNA was synthesized using Superscript II (Invitrogen) as per the manufacturer’s instructions. SYBR Green detection (Applied Biosystems) was used for real-time PCR and was performed and analysed using ViiA7 Real Time PCR System (Life Technologies) and software.

The Mitochondrial DNA (mtDNA) copy number of each embryo were quantified by relative real-time polymerase chain reaction (PCR) assay as previously described (Fragouli et al., 2017 (link)) to normalize data within samples. We used SYBR Green detection (Applied Biosystems Inc., Foster City, CA, United States) on a 7900-HT Real-Time PCR System (Applied Biosystems Inc., Foster City, CA, United States) (Figure 1A) with modified manufacturer’s protocol. The real-time PCR was performed in duplicates because of little amount DNA samples. The mean value was obtained. When the dissociation curve was inappropriate, the corresponding well data was not included in the study. We evaluated the β2-microgrobulin gene (B2M) on nuclear genome as an endogenous standard, and the tRNA of leucine gene on mtDNA (MT-TL1), and calculated the difference of the Ct value (∆Ct). Then we supposed that 100 cells were included in 1 blastocyst and calculated the mtDNA copy number included in each embryo by 100 × 2^−ΔΔCT+1. Based on previous report (Hashimoto et al., 2017 (link)), we excluded data that resulted in measurements of more than 1 × 10⁶ copies per embryo as measurement errors.

Total RNA extracted from frozen LV non‐infarct tissue and kidney tissue (RNAqueous^® Kit, Ambion, Austin, TX, USA) was reverse transcribed to cDNA. Triplicate cDNA aliquots were amplified using sequence‐specific primers (Geneworks, Adelaide, SA, Australia) with SYBR Green detection (Applied Biosystems, Foster City, CA, USA) using an ABI prism 7900HT sequence detection system (Applied Biosystems). Messenger RNA expression was quantified for transforming growth factor (TGF) β₁, connective tissue growth factor (cTGF), collagen I, collagen IV, atrial natriuretic peptide (ANP), β‐myosin heavy chain (β‐MHC) and IL‐6. Quantitation was standardized to the housekeeping genes GAPDH (cardiac tissue) and 18S (renal tissue). The primer pair sequences are as previously described 12.

Following the manufacturer’s instructions, the ChIP assay was performed by the EZ-CHIP™ chromatin immunoprecipitation kit (Merck Millipore). Briefly, BGSCs and differentiated glioma cells were lysed, and anti-PAX3 polyclonal antibodies (sc-34918, Santa Cruz Biotechnology) was used in the chromatin immunoprecipitation. In ChIP-qPCR assay, primers of the p53 promoter were as follows (5′-3′): ATGTTAGTATCTACGGCACCAG (forward) and CAGCCCGAACGCAAAGTG (reverse). By ABI 7500 with SYBR Green detection (Applied Biosystems), qRT-PCR was carried out according to the standard protocol. To account for chromatin sample preparation differences (ΔCp_{Normalized ChIP}), input DNA (non-IP enriched) values were used to normalize each ChIP DNA fraction’s Cp (crossing point) value inputting DNA fraction Cp value. Based on the normalized IgG only IP fraction Cp value ΔΔCp = (ΔCp_{Normalized ChIP} − (ΔCp_{Normalized IgG})), the normalized ChIP fraction Cp values were adjusted. Above the sample specific background, the ChIP assay site fold enrichment was then calculated as 2^(−ΔΔCp) (Brooks et al., 2016 (link)).