DNA was extracted from brain tissue using the DNeasy Blood & Tissue Kit (Qiagen, Germany) according to the manufacturer’s protocol. TaqMan qPCR was performed with Kapa Probe fast qPCR Mix (Rox Low) on a Bio-Rad CFX96 Real-Time System C1000 Touch ThermalCycler with the forward (5′-AGCAACCAGCTACCGTTTAT-3′) and reverse (5′-GTACCTGTCGGTTTACCATCTT-3′) primers and 6-FAM-TACCATGTTTCGCAGAAGCCCTGA-TAMRA as the detection probe. The primers were based on single copy of P. gingivalis arginine–specific cysteine-proteinase gene (108 (link)). Duplicate samples were assayed in a total volume of 10 μl, containing 100 ng of template brain genomic DNA solution, TaqMan Universal PCR Master Mix (2×) (Kapa Biosystems, USA), and the specific set of primers (final concentration, 5 μM) and probe (final concentration, 4 μM) (GenoMed, Poland), corresponding to 562.5 nM of forward and reverse primers and 100 nM of the probe. After an initial incubation step of 2 min at 50°C and denaturation for 95°C for 20 s, 40 PCR cycles (95°C for 20 s and 60°C for 30 s) were performed. The number of copies of the P. gingivalis genome was calculated by matching Cq values with a standard curve prepared from serial dilutions of cultured P. gingivalis W83 (WT).
Cfx96 real time system c1000 touch thermal cycler
Manufactured by Bio-Rad
Sourced in United States, Germany
The CFX96 Real-Time System C1000 Touch Thermal Cycler is a laboratory instrument designed for real-time PCR analysis. It features a 96-well capacity, a touch screen interface, and temperature control capabilities. The device is capable of performing real-time polymerase chain reaction experiments.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (22 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (12 mentions)
Trizol reagent, by Thermo Fisher Scientific (12 mentions)
Trizol, by Thermo Fisher Scientific (10 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (6 mentions)
Iscript reverse transcription supermix, by Bio-Rad (6 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (6 mentions)
Aurum total rna mini kit, by Bio-Rad (5 mentions)
Itaq universal sybr green supermix, by Bio-Rad (5 mentions)
Iscript cdna synthesis kit, by Bio-Rad (5 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (4 mentions)
Cfx manager 3, by Bio-Rad (4 mentions)
Sypro orange, by Thermo Fisher Scientific (4 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Iq sybr green supermix, by Bio-Rad (4 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Rnase free dnase kit, by Qiagen (3 mentions)
Geneamp pcr system 9700, by Thermo Fisher Scientific (3 mentions)
Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (3 mentions)
109 protocols using cfx96 real time system c1000 touch thermal cycler
1
Quantifying P. gingivalis DNA in Brain
2
Total RNA Isolation and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNeasy kit (Qiagen) was used for total RNA isolation. Total RNA (2 μg) was used to make cDNA using the iScript Reverse Transcription Supermix Kit (Bio-Rad Laboratories). RT-qPCR was conducted using the CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad Laboratories). PCR reactions were performed using SYBR Green Master Mix (Applied Biosystems #4367659). 2-ΔΔCt values were compared between target genes and GAPDH to normalize values.
3
Quantitative Analysis of Gf KS Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the Maxwell 16 AS2000 instrument with a Maxwell RSC Plant RNA Kit (Promega, AS1500, Madison, WI). RNA was quantified with a NanoDrop™ 2000 (Thermo Scientific) and 25 ng was used once linear range had been identified. Relative abundance (ΔCt) of transcript levels for GfKS was measured using Superscript IV One-Step RT-PCR System (Thermo Fisher Scientific, 12594100, Waltham, MA) with EvaGreen (Biotium, 31000, Hayward, CA) and a CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad). Relative abundance was compared with housekeeping genes histone H3 (XP_016270870.1) and actin (XP_016271443.1). Primers are listed in Addition file 2 : Table S2.
4
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissues and cells using the RNeasy Mini Kit and RNase‐Free DNase Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions with the deoxyribonuclease treatment performed on the column. RNA purity and yield were assessed by evaluating the A260/A280 ratio and concentration using the NanoDrop One Spectrophotometer (ThermoFisher Scientific, Waltham, MA). The One‐Step RT‐PCR Universal Master Mix reagent (ThermoFisher Scientific) was used to quantify mRNA levels of the selected target genes. Quantitative real‐time polymerase chain reaction (PCR) was performed with the CFX96 Real‐Time System C1000 Touch Thermal Cycler (Bio‐Rad, Hercules, CA) using predesigned primer–probe sets (ThermoFisher Scientific) for 5‐HTR2B (Mm00434123_m1), SLC25A4 (solute carrier family 25), also known as ANT‐1 (adenine nucleotide translocase 1; Mm01207393_m1), and the reference gene PPIB (peptidylprolyl isomerase B; Mm00478295_m1) in a 10‐μL reaction volume. The thermocycling parameters for each reaction were 48 ℃ for 30 minutes and 95 ℃ for 10 minutes followed by 40 cycles of 95 ℃ for 15 seconds and 60 ℃ for 60 seconds. Values measured for each primer/probe set were normalized to PPIB.
5
Quantitative RT-PCR analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA samples from SCs cultures were extracted using TRIzolTM (Thermo Fisher) according to the manufacturer's protocol and quantified with NanoDrop2000 (Thermo Fisher). Pure RNA was obtained after DNAse treatment with a specific kit (Merk Life Science); 1 μg of RNA was reverse-transcribed to cDNA using iScript™ Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories). Primers were designed by the PrimerBlast software (NIH, Bethesda, MD, USA); primer sequences are presented in Table 1 . The primer efficiencies were experimentally set up for each couple of primers. An amount of 10 ng of cDNA for each sample was used for real-time PCR. qRT-PCR was performed by measuring the incorporation of SsoFastTM EvaGreen® dye (Bio-Rad Laboratories) with a CFX 96 Real Time System-C1000 touch thermal cycler (Bio-Rad). Data analysis was performed using the CFX Manager 2.0 software (Bio-Rad Laboratories). The threshold cycle number (Ct) values of both the calibrator and the samples of interest were normalized to the geometric mean of Ct of the endogenous housekeeping genes. Data analysis was performed with the comparative threshold cycle and results are expressed as 2−ΔΔCt. RNA obtained from control samples was used as a reference.
6
qRT-PCR Analysis of Prostate Cancer Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the indicated tissues using an RNeasy Mini Kit (QIAGEN), and then reverse transcribed using an iScript cDNA Synthesis Kit and analyzed by qRT-PCR using SSoAdvanced Universal SYBR Green Supermix on a CFX96 Real-Time System C1000 Touch Thermal Cycler (all from Bio-Rad). Data were normalized to β-actin. The following primers were used: β-actin forward, 5’-AAGGCCAACCGTGAAAAGAT and reverse, 5’-GTGGTACGACCAGAGGCATAC [77 (link)]; Ki67 forward, 5’-ATCATTGACCGCTCCTTTAGGT and reverse, 5’- GCTCGCCTTGATGGTTCCT; transgene forward, 5’- AAGCTCTAAGATTCCAACCTATGG and reverse, 5’- AGCCTCATCATCACTAGATGGC; AR forward, 5’-TGCTGCTCTTCAGCATTATTCCAGT and reverse, 5’- GGTTTTGGGTATTAGGGTTTCCAAA; Nkx3–1 forward, 5’- GACTGTGAACATAATCCAGGGG and reverse, 5’- TGATGGCTGAACTTCCTCTCC’ Tmprss2 forward 5’- CAGTCTGAGCACATCTGTCCT and reverse, 5’- CTCGGAGCATACTGAGGCA; CXCR4 forward, 5’-GAAGTGGGTTCTGGAGACTATG and reverse, 5’-TTGCCGACTATGCCAGTCAAG; SRD5A1 forward, 5’-GCGAGGCAGCATCATCAGT and reverse, 5’-GACACTCAGCTTATGGAAGACAACA; SRD5A2 forward, 5’-TGGGTCTCTTCTCCGCACAT and reverse, 5’-GCCTCTGGTGAGCAATGAGTAA; Aurora Kinase A forward, 5’- CTGGATGCTGCAAACGGATAG and reverse, 5’- CGAAGGGAACAGTGGTCTTAACA; Chromogranin A forward, 5’-ATCCTCTCTATCCTGCGACAC and reverse, 5’-GGGCTCTGGTTCTCAAACACT; Synaptophysin forward, 5’- CAGTTCCGGGTGGTCAAGG and reverse, 5- ACTCTCCGTCTTGTTGGCAC.
7
Comprehensive RNA Extraction and qPCR Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the Aurum™ Total RNA Mini Kit (Bio Rad) and 2 µg of RNA was used to produce cDNA via the SuperScript® III First-Strand Synthesis System for RT-PCR (Invitrogen). Intron-spanning primers designed for gene expression analysis are summarized in Table 1
8
Thermal Stability of Recombinant Mei-P26 NHL Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant Mei-P26 NHL domain and variants thereof (each at a concentration of 1 g/l) were incubated with SYPRO Orange and 20 mM Hepes, pH 7.5, 300 mM NaCl, 5 mM DTT buffer in 96-well plates followed by centrifugation (5’, 180 rcf). Subsequently, the samples were gradually heated from 4 to 98°C with a rate of 0.2°C/10 s in the CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad). The fluorescence intensity was measured using an excitation wavelength of 470 nm, whereas monitoring emission at 570 nm.
9
RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from IWAT, EWAT, RWAT, and BAT tissues was extracted using Trizol® reagent (Ambion, Life Technologies, Uppsala, Sweden) following the manufacturer’s instructions. The RNA yield was quantified in a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA).
A total of 0.5 µg of total RNA was reverse transcribed using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Madrid, Spain) in a multigene thermal cycler (Labnet, Madrid, Spain). For qPCR, the CFX96 real-time system C1000 touch thermal cycler (Bio-Rad, Barcelona, Spain) with the iTaq™ Universal SYBR® Green Supermix (Bio-Rad, Barcelona, Spain) was used.
Gene expression levels in IWAT, EWAT, RWAT, and BAT tissues and 3T3-L1 were assessed for the genes indicated in (Table S2 ). The primers for the different genes are also described in Table S2 and were obtained from Biomers.net (Ulm, Germany). The relative expression of each mRNA was calculated as a percentage of the vehicle group using the 2−∆∆Ct method [37 (link)], with Ppia, Actb, and Hprt1 as the reference genes. Each PCR was performed at least in duplicate.
A total of 0.5 µg of total RNA was reverse transcribed using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Madrid, Spain) in a multigene thermal cycler (Labnet, Madrid, Spain). For qPCR, the CFX96 real-time system C1000 touch thermal cycler (Bio-Rad, Barcelona, Spain) with the iTaq™ Universal SYBR® Green Supermix (Bio-Rad, Barcelona, Spain) was used.
Gene expression levels in IWAT, EWAT, RWAT, and BAT tissues and 3T3-L1 were assessed for the genes indicated in (
10
Quantification of CXCL12 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the Trizol Reagent (Life Technologies, Cat. # 15596018). Complementary DNAs were generated using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cat. # 4368814). PCR reactions were performed on CFX96™ Real-Time System C1000 Touch thermal cycler (Bio-Rad) using Q-PCR Master Mix (Gendepot, Cat. # Q5600-005). The Sybr green primers were as follows: Mouse Cxcl12: 5′-TGCATCAGTGACGGTAAACCA-3′, 5′-AGATGCTTGACGTTGGCTCT-3′, human Cxcl12: 5′-TTCTTCAGCCGTGCAACAATC-3′, 5′-AGATGCTTGACGTTGGCTCT-3′; 18S RNA: 5′-AAGTCCCTGCCCTTTGTACACA-3′, 5′-GATCCGAGGGCCTCACTAAAC-3′. Gene expression was normalized to 18S RNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!