Log In Sign up
The largest database of trusted experimental protocols

Mission trc shrna library

Manufactured by Merck Group
Visit Supplier

The Mission TRC shRNA library is a collection of short hairpin RNA (shRNA) constructs designed for gene knockdown in various cell lines and organisms. The library targets a wide range of genes and can be used for functional genomics research and screening applications.

Automatically generated - may contain errors

Lab products found in correlation

Polybrene, by Merck Group (2 mentions) Pspax2, by Addgene (2 mentions) Pmd2 g, by Addgene (2 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions) Pgl3 basic plasmid, by Promega (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Pcdna3.1 vector, by Thermo Fisher Scientific (1 mentions) Psicheck 2 vector, by Promega (1 mentions) Noti hf, by New England Biolabs (1 mentions) Nhei hf, by New England Biolabs (1 mentions) Xhoi, by New England Biolabs (1 mentions) Versene edta, by Thermo Fisher Scientific (1 mentions) Shctrl, by Merck Group (1 mentions) Pgl3 basic vector, by Promega (1 mentions) Metafectene pro, by Biontex (1 mentions) Mycoplasma pcr detection kit, by Beyotime (1 mentions) Egm 2 bulletkit medium, by Lonza (1 mentions)

Spelling variants of this product

MISSION shRNA (251 citations) MISSION shRNA library (127 citations) MISSION library (20 citations) MISSION TRC library (15 citations) Mission TRC shRNA (13 citations) TRC library (9 citations) TRC shRNA library (3 citations) MISSION® TRC version 1 shRNA library (2 citations) MISSION TRC shRNA human library (2 citations) MISSION TRC-Mm 1.0 shRNA library (2 citations)

23 protocols using mission trc shrna library

1

Stable DYRK1A and DYRK1B Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stable RNAi knockdown experiments were performed by lentiviral shRNA transductions as described in [16 (link)]. The following shRNA constructs selected from the Mission TRC shRNA library (Sigma) were used: shRNA DYRK1A (TRCN0000000526), shRNA DYRK1B#1 (TRCN0000002139), shRNA DYRK1B#2 (TRCN0000355722), shRNA DYRK1B#3 (TRCN0000355721), shSUFU (TRCN0000019466) and scrambled control shRNA (SHC002) (Sigma). The shGLI1 construct has been described in [16 (link)]. The functionality of shRNAs was validated by Western blot analysis using antibodies listed below.
Gruber W., Hutzinger M., Elmer D.P., Parigger T., Sternberg C., Cegielkowski L., Zaja M., Leban J., Michel S., Hamm S., Vitt D, & Aberger F. (2016). DYRK1B as therapeutic target in Hedgehog/GLI-dependent cancer cells with Smoothened inhibitor resistance. Oncotarget, 7(6), 7134-7148.
+ Open protocol
+ Expand
2

Cloning and Characterization of SNAI2 and MARCKS UTRs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The full length of SNAI2-3'UTR (Gene ID: 6591; NCBI Reference Sequence: NM_003068.4) was cloned into pCDH vector (No.CD510B-1, System Biosciences) using restriction enzymes NheI-HF and NotI-HF (New England Biolabs). And the full length of SNAI2-3'UTR was also cloned into pcDNA3.1 vector (Invitrogen). Additionally, a fragment of MARCKS-3'UTR (1124bp, from+43 to +1166; Gene ID: 6591; NCBI Reference Sequence: NM_003068.4) was cloned into psiCHECKTM-2 vector (Promega) using restriction enzymes XhoI and NotI (New England Biolabs). The reconstructed vector was named psi-MARCKS-3'UTR. Primers for cloning were shown in Table S1 (supplementary data). PLKO-Scramble-shRNA was purchased from Addgene (Addgene #1864). PLKO-MARCKS-shRNA plasmids are constructed according to PLKO.1 protocol. The sequences of MARCKS shRNAs are obtained from The RNAi Consortium (TRC, MISSION® TRC shRNA library, Sigma) and shown in Table S1 (supplementary data).
Li J., Wang J., Yue H, & Lu X. (2019). SNAI2 3'untranslated region promotes the invasion of ovarian cancer cells by inducing MARCKS expression. Journal of Cancer, 10(11), 2480-2487.
+ Open protocol
+ Expand
3

Lentiviral Knockdown of GATA6-AS1 in hPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
HIV-based lentiviral vectors expressing the target-specific shRNA sequences against human GATA6-AS1 and a scrambled control were obtained from The RNAi Consortium (TRC, MISSION® TRC shRNA library, Sigma-Aldrich). The shRNA sequences against GATA6-AS1 were custom designed as following: shRNA1, CCTGGAGAGTTTCTGATATTT; and shRNA2, CCCAGGTAAATCCAAGTAAAT. These shRNAs did not target any other known genes in the bioinformatic validation by Sigma Aldrich.
Undifferentiated hPSCs were dissociated with Versene/EDTA (Thermo Fisher Scientific, Waltham, MA) and 5×105 cells were infected with concentrated lentivirus expressing either the control shRNA or GATA6-AS1 shRNA (pool of GATA6-AS1 shRNA1 and shRNA2) at 1 multiplicity of infection (MOI) and seeded into a Matrigel-coated 6-well plate in 1 mL MEF-CM or mTeSR1 medium containing 6 μg/mL polybrene (Sigma-Aldrich, St. Louis, MO) and 10 μM Rock inhibitor Y-27632 (Stemgent, Cambridge, MA). The next day, cells were replaced with fresh MEF-CM and allowed to expand for 3 days. Cells were then treated with 0.5 μg/mL puromycin in MEF-CM or mTeSR1 medium for an additional 7 days and antibiotics-selected hPSC pooled colonies were expanded to set up for cardiomyocyte differentiation.
Jha R., Li D., Wu Q., Ferguson K.E., Forghani P., Gibson G.C, & Xu C. (2020). A long non-coding RNA GATA6-AS1 adjacent to GATA6 is required for cardiomyocyte differentiation from human pluripotent stem cells. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(11), 14336-14352.
+ Open protocol
+ Expand
4

Lentiviral Stable Cell Line Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols
For stable cell line generation, lentiviruses were produced in the HEK293T cell line using the pLenti-CMV-GFP-puro vector to overexpress ectopic GFP, CDK12 WT and T548A mutant. For shRNA-mediated knockdown of CDK12, lentiviruses were produced using vectors from the Mission TRC shRNA library (Sigma-Aldrich) targeting CDK12 (#1 TRCN0000001795, #2 TRCN0000001797, #3 TRCN0000001798). Two days after infection, A375 were selected with 2 μg/ml puromycin. HEK293 and HEK293T cells were transfected by calcium phosphate precipitation. Briefly, plasmid and CaCl2 2 M were diluted v/v in 2× HBS (274 mM NaCl, 1.5 mM Na2HPO4, 55 mM HEPES, pH 7) before adding slowly to cells.
Houles T., Lavoie G., Nourreddine S., Cheung W., Vaillancourt-Jean É., Guérin C.M., Bouttier M., Grondin B., Lin S., Saba-El-Leil M.K., Angers S., Meloche S, & Roux P.P. (2022). CDK12 is hyperactivated and a synthetic-lethal target in BRAF-mutated melanoma. Nature Communications, 13, 6457.
+ Open protocol
+ Expand
5

Lentiviral Knockdown and Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral constructs for short hairpin RNA (shRNA)-mediated knockdown (KD) were purchased from MISSION® TRC shRNA library (Sigma-Aldrich, St. Louis, MO): ANXA11 (TRCN0000056377), ANO1 (TCRN0000040263) and shRNA control (SHC002). The lentiviral construct for annexin A11-mEmerald overexpression was obtained from Addgene (Watertown, MA). Lentivirus was produced as previously described.37 (link) Transduced H69 cholangiocytes were selected with 1 μg/ml puromycin to obtain stable KD and overexpression cell lines.
Herta T., Kersten R., Chang J.C., Hubers L., Go S., Tolenaars D., Paulusma C.C., Nathanson M.H., Elferink R.O., van de Graaf S.F, & Beuers U. (2021). Role of the IgG4-related cholangitis autoantigen annexin A11 in cholangiocyte protection. Journal of hepatology, 76(2), 319-331.
+ Open protocol
+ Expand
6

Screening and Validation of shRNA Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols
All shRNA vectors were obtained from the Sigma MISSION TRC shRNA library as a glycerol stock. The target sequence and TRC number for each shRNA are as follows: shGFP GCAAGCTGACCCTGAAGTTCAT; shGOT1 #1 GCAGAGTTCCAAGACAGGATA (TRCN0000034784); shGOT1 #2 GCGTTGGTACAATGGAACAAA (TRCN0000034785); shGOT2 #1 TTTGCAGACCATAGTGAAGGC (TRCN0000034824); shGOT2 #2; TTTGGGCAGAAAGACATCTCG (TRCN0000034825) shCOX7A2L #2 CGATTCCACAGTGTATGATT (TRCN0000300340); shCOX7A2L #4 CTGCCTGACCAAATGCTTTA (TRCN0000046302). These shRNAs were selected after screening 1–5 shRNAs by qPCR and western blot.
Lentivirus were produced by transfecting 293T cells with pLKO constructs, pMD2.G (Addgene, plasmid #12259), and psPAX2 (Addgene, plasmid #12260) using standard jetPEI protocol (Polyplus). All experiments were conducted using pools of cells after selection.
Hollinshead K.E., Parker S.J., Eapen V.V., Encarnacion-Rosado J., Sohn A., Oncu T., Cammer M., Mancias J.D, & Kimmelman A.C. (2020). Respiratory Supercomplexes Promote Mitochondrial Efficiency and Growth in Severely Hypoxic Pancreatic Cancer. Cell reports, 33(1), 108231.
+ Open protocol
+ Expand
7

Plasmid construction and transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
The DKK1 expression plasmid was a kind gift from Guohong Hu (Chinese Academy of Sciences, Shanghai). The shRNA plasmids of human genes were obtained from The RNAi Consortium (MISSION® TRC shRNA library, Sigma-Aldrich). For luciferase reporter plasmids of DKK1 promoters, the DNA fragments upstream of DKK1 gene carrying TCF4 binding sites were cloned into the pGL3-Basic plasmid (Promega). The mutant constructs were generated using the QuickChange II XL site-directed mutagenesis kit (Stratagene). The coding sequence of the firefly luciferase, DKK1 (HOMO) and DKK1 (Mus) genes were amplified and sub-cloned into the pSin vector to generate expressing plasmid. The sequences of shRNAs, primers for cloning and qRT-PCR are listed in Supplementary Table 3. The transfection was carried out using Lipofectamine 3000 (Invitrogen).
Wu M., Zhang X., Zhang W., Chiou Y.S., Qian W., Liu X., Zhang M., Yan H., Li S., Li T., Han X., Qian P., Liu S., Pan Y., Lobie P.E, & Zhu T. (2022). Cancer stem cell regulated phenotypic plasticity protects metastasized cancer cells from ferroptosis. Nature Communications, 13, 1371.
+ Open protocol
+ Expand
8

Modulation of IL8 and CTNNB1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The shRNA plasmids of IL8 and CTNNB1 were obtained from The RNAi Consortium (MISSION® TRC shRNA library, Sigma-Aldrich). For luciferase reporter plasmids containing the IL8 promoter, the DNA fragment upstream of the IL8 gene carrying the TCF4 binding site was cloned into the pGL3-Basic plasmid (Promega, Wisconsin, America). The mutant constructs were generated using the QuickChange II XL site-directed mutagenesis kit (Stratagene, California, America). The firefly luciferase gene was amplified and sub-cloned into the pSin vector to generate the luciferase plasmid. The sequences of shRNAs, primers for cloning and qRT-PCR are listed in Additional file 1: Table S1. Transfection was carried out using Lipofectamine 3000 (Invitrogen, California, America).
Wu M., Zhang X., Zhang W., Yan L., Liu X., Zhang M., Pan Y., Lobie P.E., Han X, & Zhu T. (2023). Paracrine secretion of IL8 by breast cancer stem cells promotes therapeutic resistance and metastasis of the bulk tumor cells. Cell Communication and Signaling : CCS, 21, 59.
+ Open protocol
+ Expand
9

Knockdown of C17orf91 Using shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
PLKO-Scramble-shRNA was purchased from Addgene(Addgene #1864). PLKO-C17orf91-shRNA plasmids were constructed according to PLKO.1 protocol. The sequences of C17orf91 shRNA were obtained from The RNAi Consortium (TRC, MISSION® TRC shRNA library, Sigma) and shown in Additional file 1: Table S1.
Li J., Yu H., Xi M, & Lu X. (2016). Long noncoding RNA C17orf91 is a potential prognostic marker and functions as an oncogene in ovarian cancer. Journal of Ovarian Research, 9, 49.
+ Open protocol
+ Expand
10

Knockdown of Autophagy Genes in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
shRNA vectors (pLKO.1 puro) were obtained from the Sigma MISSION TRC shRNA library. The sequences and RNAi Consortium clone IDs for the shRNAs used are as follows: shMYOF#1 (human): 5’- GAAAGAGCTGTGCATTATAAA-3’ (TRCN0000320397); shMYOF#2 (human): 5’- GAAAGAGCTGTGCATTATAAA-3’ (TRCN0000001522); shATG3#1 (human): 5’-GATGTGACCATTGACCATATT-3’ (TRCN0000148120); shATG3#2 (human): 5’-GCTGTCATTCCAACAATAGAA-3’ (TRCN0000147381); shATG7#1 (human): 5’-CCCAGCTATTGGAACACTGTA-3’ (TRCN0000007587); shATG7#2 (human): 5’-GCCTGCTGAGGAGCTCTCCAT-3’ (TRCN0000007584); shGFP: 5’-TGCCCGACAACCACTACCTGA-3’ (TRCN0000072186). Pre-designed silencer select siRNAs against MYOF were ordered from Thermo Fischer (Cat# 4392420). shGFP was used as the control hairpin.
Gupta S., Yano J., Mercier V., Htwe H.H., Shin H.R., Rademaker G., Cakir Z., Ituarte T., Wen K.W., Kim G.E., Zoncu R., Roux A., Dawson D.W, & Perera R.M. (2021). Lysosomal retargeting of Myoferlin mitigates membrane stress to enable pancreatic cancer growth. Nature cell biology, 23(3), 232-242.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!