Log In Sign up
The largest database of trusted experimental protocols

Anti podocin antibody

Manufactured by Merck Group
Visit Supplier
Sourced in United States

The Anti-podocin antibody is a laboratory reagent used for the detection and analysis of the podocin protein in biological samples. Podocin is a key structural component of the glomerular filtration barrier in the kidney. The antibody can be used in various immunoassay techniques, such as Western blotting and immunohistochemistry, to study the expression and localization of podocin in research and clinical settings.

Automatically generated - may contain errors

Lab products found in correlation

Image pro plus 6, by Media Cybernetics (2 mentions) Fluoview fv1000, by Olympus (2 mentions) Anti nlrp3 antibody, by Abcam (2 mentions) Anti asc antibody, by Santa Cruz Biotechnology (2 mentions) Anti desmin antibody, by Thermo Fisher Scientific (2 mentions) Anti tubulin antibody, by Cell Signaling Technology (1 mentions) Anti gapdh antibody, by Proteintech (1 mentions) Anti zo 1, by Abcam (1 mentions) Anti rhoa antibody, by Cell Signaling Technology (1 mentions) Dneasy kit, by Qiagen (1 mentions) Alexa fluor 488, by Thermo Fisher Scientific (1 mentions) Alexa 488, by Thermo Fisher Scientific (1 mentions) Alexa 594 labeled secondary antibody, by Thermo Fisher Scientific (1 mentions) Anti ly6g antibody, by Abcam (1 mentions) Anti lamp1 antibody, by Abcam (1 mentions) Fitc phalloidin, by Merck Group (1 mentions) Anti nfatc1 antibody, by Santa Cruz Biotechnology (1 mentions) Anti synaptopodin antibody, by Santa Cruz Biotechnology (1 mentions) Anti podocin, by Merck Group (1 mentions) Alexa 488 or alexa 594labeled secondary antibodies, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

Podocin (15 citations) Anti-podocin (14 citations) Podocin antibody (5 citations) Rabbit anti-podocin antibody (2 citations) Rabbit anti-podocin primary antibody (2 citations)

5 protocols using anti podocin antibody

1

Antibody-based Protein Detection in Kidney

Check if the same lab product or an alternative is used in the 5 most similar protocols
Anti-ZO-1 (zonula occludens-1) antibody was from Abcam (UK). Anti-podocin antibody and horseradish peroxidase (HRP)-conjugated goat-anti-rabbit/mouse antibody were from Sigma (USA). Anti-nephrin antibody was from Prosci (USA). Anti-RhoA antibody and anti-tubulin antibody were from Cell Signaling Technology (USA). Anti-ROCK1 antibody and anti-GAPDH antibody were from Proteintech (USA).
Huang N., Zhang X., Jiang Y., Mei H., Zhang L., Zhang Q., Hu J, & Chen B. (2018). Increased levels of serum pigment epithelium-derived factor aggravate proteinuria via induction of podocyte actin rearrangement. International Urology and Nephrology, 51(2), 359-367.
+ Open protocol
+ Expand
2

Podocyte-specific Knockout Confirmation

Check if the same lab product or an alternative is used in the 5 most similar protocols
To confirm the podocyte-specific knock out of Tfam, Pgc-1α and Drp1, respectively, podocytes were ex vivo isolated after Dynabead perfusion and several digestion steps. Finally, podocytes were captured by anti-podocin antibody (P0372, Sigma) coupled to Alexa Fluor 488 (Z25302, Thermo Scientific) (Pgc-1α) or isolated due to their GFP-signal (Tfamflox/flox;Tomato/eGFP;hNPHS2Cre+ and Drp1flox/flox;Tomato/eGFP;hNPHS2Cre+ mice). DNA was isolated using DNeasy kit (QIAGEN, 69504) following manufacturer`s instructions. PRC was performed using following primers: Tfam forward 5′-CTGCCTTCCTAGCCCGG-3′, Tfam reverse 1 5′-GTAACAGCAGACAACTTGTG-3′, Tfam reverse 2 5′-CTCTGAAGCACATGGTCAAT-3′. Pgc-1α alpha primer: Pgc-1α WT: frwd 5′-ACCTGTCTTTGCCTATGATTC, reverse 5′- CCAGTTTCTTCATTGGTGTG −3′; Pgc-1α KO forward: 5′-TCCAGTA
GGCAGAGATTTATGAC-3′, reverse: 5′-CCAACTGTCTATAATTCCAGTTC-3′.
Drp1: D1 (5′-CACTGAGAGCTCTATATGTAGGC-3′), D3 (5′-ACCAAAGTAAGGAAT
AGCTGTTG-3′) and D5 (5′-GAGTACCTAAAGTGGACAAGAGGTCC-3′).
Brinkkoetter P.T., Bork T., Salou S., Liang W., Mizi A., Özel C., Koehler S., Hagmann H.H., Ising C., Kuczkowski A., Schnyder S., Abed A., Schermer B., Benzing T., Kretz O., Puelles V.G., Lagies S., Schlimpert M., Kammerer B., Handschin C., Schell C, & Huber T.B. (2019). Anaerobic Glycolysis Maintains the Glomerular Filtration Barrier Independent of Mitochondrial Metabolism and Dynamics. Cell Reports, 27(5), 1551-1566.e5.
+ Open protocol
+ Expand
3

Immunostaining and Colocalization Analysis of Kidney Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
Frozen slides with mouse kidney tissue were fixed in acetone, blocked, then incubated with primary antibodies, including anti-podocin antibody (1:100; Sigma-Aldrich, St. Louis, MO), anti-desmin antibody (1:100; Invitrogen, Carlsbad, CA), anti-Asm antibody (1:100; LSBio, Seattle, WA), anti-Cre antibody (1:100; Millipore, Temecula, CA), anti-ceramide antibody (1:100; ALEXIS, Farmingdale, NY), anti-NLRP3 antibody (1:50; Abcam, Cambridge, MA), anti-ASC antibody (1:50; Santa Cruz Biotechnology, Dallas, TX), anti-Ly6G antibody (1:50; Abcam, Cambridge, MA), anti-VPS16 antibody (1:50; proteintech, Rosemont, IL), and anti-Lamp-1 antibody (1:50; Abcam, Cambridge, MA), overnight at 4°C. Immunofluorescent staining was accomplished by incubating slides with Alexa-488 or Alexa-594-labeled secondary antibodies (Invitrogen, Carlsbad, CA) for 1 hour at room temperature [34 (link)]. Slides were washed, mounted, and observed by a confocal laser scanning microscope (FluoView FV1000, Olympus, Tokyo, Japan). Image Pro Plus 6.0 (Media Cybernetics, Bethesda, MD) was used to analyze colocalization which was expressed as Pearson correlation coefficient (PCC).
Huang D., Li G., Zhang Q., Bhat O.M., Zou Y., Ritter J.K, & Li P.L. (2021). Contribution of Podocyte Inflammatory Exosome Release to Glomerular Inflammation and Sclerosis during Hyperhomocysteinemia. Biochimica et biophysica acta. Molecular basis of disease, 1867(7), 166146.
+ Open protocol
+ Expand
4

Immunofluorescence Analysis of Podocyte Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Frozen kidney tissues were firstly cut into 4 μm thick sections and were incubated with anti-synaptopodin antibody (1:100, Santa Cruz, sc-21537), anti-podocin antibody (1:100, Sigma, P0372), anti-NFATc1 antibody (1:50, Santa Cruz, sc-13033) overnight at 4 °C, followed by incubation with fluorescein-conjugated secondary antibody. The results were examined with immunofluorescence microscopy (Leica DMLB, Wetzlar, Germany). For in vitro cultured podocytes, coverslips containing podocytes were firstly fixed with 4% paraformaldehyde and permeabilized in 0.3% Triton X-100 for 10 min. Podocytes were blocked with 10% FBS for 1 h and then incubated with FITC-phalloidin (1:100, Sigma, P5282), anti-synaptopodin, anti-podocin, and anti-NFATc1 antibody.
Shen X., Weng C., Wang Y., Wang C., Feng S., Li X., Li H., Jiang H., Wang H, & Chen J. (2020). Lipopolysaccharide-induced podocyte injury is regulated by calcineurin/NFAT and TLR4/MyD88/NF-κB signaling pathways through angiopoietin-like protein 4. Genes & Diseases, 9(2), 443-455.
+ Open protocol
+ Expand
5

Immunofluorescence Analysis of Kidney Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
Frozen slides with mouse kidney tissue were fixed in acetone, blocked, then incubated with primary antibodies, including anti-podocin antibody (1:100; Sigma-Aldrich, St. Louis, MO), anti-desmin antibody (1:100; Invitrogen, Carlsbad, CA), anti-NLRP3 antibody (1:50; Abcam Biotechnology, Cambridge, MA), anti-ASC antibody (1:50; Santa Cruz Biotechnology, Dallas, TX), and anti-CD8 antibody (1:100; Abcam Biotechnology, Cambridge, UK), overnight at 4 °C. Immunofluorescent staining was accomplished by incubating slides with Alexa-488- or Alexa-594-labeled secondary antibodies (Invitrogen, Carlsbad, CA) for 1 h at room temperature [47 (link)]. Slides were washed, mounted, and observed by a confocal laser scanning microscope (FluoView FV1000, Olympus, Tokyo, Japan). Image Pro Plus 6.0 (Media Cybernetics, Bethesda, MD) was used to analyze colocalization which was expressed as Pearson correlation coefficient (PCC).
Huang D., Kidd J.M., Zou Y., Wu X., Gehr T.W., Li P.L, & Li G. (2023). Regulation of NLRP3 Inflammasome Activation and Inflammatory Exosome Release in Podocytes by Acid Sphingomyelinase During Obesity. Inflammation, 46(5), 2037-2054.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!