Sybr green detection kit

Total RNA was extracted from frozen DTC tissues and cells using the TRIzol reagent (Invitrogen), and the Prime Script RT reagent kit with gDNA Eraser (Takara) was used to synthesize cDNA. Quantitative real‐time PCR was performed using the SYBR Green Detection kit (Takara). The relative mRNA expression was determined by the 2‐ΔΔCT method and β‐actin was used as the reference gene for normalization. Experiments were repeated three times. Detailed primer sequences were as follows:
SLC27A2: fwd: 5′‐CTCTTGCCTTGCGGACTAAAT‐3′, rvs: 5′‐CCTCGTAAGCCATTTCCCAGT‐3′;
β‐actin: fwd: 5′‐GTGCCAAAATGCTCAAGGAAAT‐3′, rvs: 5′‐GAAGGGCAGCTTTCTTTGTGAC‐3′.

Epithelium samples were divided into 3 groups due to the low amount of RNA from the lens epithelium, among which 8 to 12 epithelium samples were pooled together in the ARC group and 9 to 13 epithelium samples were pooled together in the DMC group. Total RNA from all epithelium samples was extracted using TRIzol reagent (15,596,026, Invitrogen, Carlsbad, CA, USA) and reverse transcribed with the RT reagent Kit (RR014A, Takara Bio, Inc, Japan) according to the manufacturer’s protocol. mRNA expression was detected using a SYBR Green detection kit (RR820A, Takara, Japan) on a LightCycler 480II Real-Time PCR System (Roche, Switzerland). GAPDH was detected as the internal control. RNA expression was determined by the 2^−ΔΔCT method.
The forward primer of TGBF1 mRNA was GAAATTGAGGGCTTTCGCCTTAG, and the reverse primer of TGBF1 mRNA was GGTAGTGAACCCGTTGATGTCCA. The forward primer of TGBF2 mRNA was AAGCCAGAGTGCCTGAACAA, and the reverse primer of TGBF2 mRNA was GCGCTGGGTTGGAGATGTTA. The forward primer of TGBF3 mRNA was TGCCAAAGAAATCCATAAATTCGAC, and the reverse primer of TGBF3 mRNA was AGGTAATTCCTTTAGGGCAGACAGC.

RNA extraction from PBMCs was performed using a Total RNA Extraction Miniprep kit (Viogene, Taiwan) based on the manufacturer's instruction. The RNA purity and concentration were determined using a NanoDrop spectrophotometer. The RNA quality was checked by agarose gel electrophoresis.
The complementary DNA (cDNA) synthesis was performed on one microgram of DNase-treated RNA using Revert Aid First Strand cDNA Synthesis kit (Thermo Scientific, Fermentas, USA).
Real-time PCR was carried out in a Rotor Gene real-time thermocycler (Qiagen, Hilden, Germany) using SYBR Green detection kit (Takara Bio, Otsu, Japan) according to the manufacturer's protocol. Primers for target genes (MnSOD and catalase) and housekeeping gene, β-actin, were purchased from Qiagen (Hilden, Germany). Standard curves were generated for all studied genes to evaluate the linear range of the real-time PCR before performing the assay on test samples. The correlation coefficients of all the standard curves were more than 0.95 indicating a good linearity, and all test samples were verified to be within this range. It should be noted that melting curve analysis and subsequent gel electrophoresis were used to confirm the specificity of PCR products. Relative gene expression was normalized to β-actin and calculated as 2^−ΔCT using the formula: 2^{−(Ct target gene−Ct β-actin)}.